EMAIL THIS PAGE TO A FRIEND

EDIL3

EGF-like repeats and discoidin I-like domains 3

63 Gene Product Result for
Synonyms: DEL1
UniProtKB ID: O43854, B2R763, O43855, Q5D094
Gene ID:
Human(10085) Summary: The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq, Jul 2008]
Mouse(13612) EGF-like repeats and discoidin I-like domains 3
Zebrafish(793444) EGF-like repeats and discoidin I-like domains 3
Horse(100073246) EGF-like repeats and discoidin I-like domains 3
cow(538062) EGF-like repeats and discoidin I-like domains 3
domestic cat(101097205) EGF-like repeats and discoidin I-like domains 3
chicken(427326) EGF-like repeats and discoidin I-like domains 3
dog(488919) EGF-like repeats and discoidin I-like domains 3
domestic guinea pig(100727824) EGF-like repeats and discoidin I-like domains 3
naked mole-rat(101712327) EGF-like repeats and discoidin I-like domains 3
sheep(101118698) EGF-like repeats and discoidin I-like domains 3
Domestic Rabbit(100341616) EGF-like repeats and discoidin I-like domains 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1428 Human EDIL3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062801 MISSION® esiRNA esiRNA human EDIL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005711 Rosetta Predictions human pricing
NM_001037987 Rosetta Predictions mouse pricing
NM_010103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124457 predicted 814
2 SASI_Hs01_00124458 predicted 1568
3 SASI_Hs02_00340132 predicted 1669
4 SASI_Hs01_00124459 predicted 903
5 SASI_Hs01_00124460 predicted 1210
6 SASI_Hs01_00124461 predicted 646
7 SASI_Hs01_00124462 predicted 1439
8 SASI_Hs01_00124463 predicted 991
9 SASI_Hs01_00124464 predicted 769
10 SASI_Hs01_00124465 predicted 482
11 SASI_Hs01_00124466 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129916 predicted 1074
2 SASI_Mm01_00129917 predicted 1481
3 SASI_Mm02_00289575 predicted 1146
4 SASI_Mm01_00129918 predicted 1005
5 SASI_Mm01_00129919 predicted 1714
6 SASI_Mm01_00129920 predicted 945
7 SASI_Mm01_00129921 predicted 1658
8 SASI_Mm01_00129922 predicted 1528
9 SASI_Mm01_00129923 predicted 1021
10 SASI_Mm01_00129924 predicted 1858
11 SASI_Mm01_00129925 predicted 1576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046833 predicted 1044
2 SASI_Mm01_00046834 predicted 1442
3 SASI_Mm02_00317806 predicted 1113
4 SASI_Mm01_00046835 predicted 973
5 SASI_Mm01_00046836 predicted 1678
6 SASI_Mm01_00046837 predicted 914
7 SASI_Mm01_00046838 predicted 1629
8 SASI_Mm01_00046839 predicted 1501
9 SASI_Mm01_00046840 predicted 989
10 SASI_Mm01_00046841 predicted 1825
11 SASI_Mm01_00046842 predicted 1418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010103
VALIDATED
EDIL3 MISSION shRNA Bacterial Glycerol Stock
EGF-like repeats and discoidin I-like domains 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010103.4-1050s21c1
Sequence:CCGGTCCCTACTATGCTCGACTTAACTCGAGTTAAGTCGAGCATAGTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010103.4-859s21c1
Sequence:CCGGCCTTGCAGAAATGGCGGAATACTCGAGTATTCCGCCATTTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010103.4-2410s21c1
Sequence:CCGGTTGATATGCAGGACCATTAATCTCGAGATTAATGGTCCTGCATATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010103.4-773s21c1
Sequence:CCGGACACATTCATAGGCTATGTTTCTCGAGAAACATAGCCTATGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010103.4-968s21c1
Sequence:CCGGGAATCGAAGGTGGGATCATATCTCGAGATATGATCCCACCTTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010103
VALIDATED
EDIL3 MISSION shRNA shRNA Plasmid DNA
EGF-like repeats and discoidin I-like domains 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010103.4-1050s21c1
Sequence:CCGGTCCCTACTATGCTCGACTTAACTCGAGTTAAGTCGAGCATAGTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010103.4-859s21c1
Sequence:CCGGCCTTGCAGAAATGGCGGAATACTCGAGTATTCCGCCATTTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010103.4-2410s21c1
Sequence:CCGGTTGATATGCAGGACCATTAATCTCGAGATTAATGGTCCTGCATATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010103.4-773s21c1
Sequence:CCGGACACATTCATAGGCTATGTTTCTCGAGAAACATAGCCTATGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010103.4-968s21c1
Sequence:CCGGGAATCGAAGGTGGGATCATATCTCGAGATATGATCCCACCTTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010103
VALIDATED
EDIL3 MISSION shRNA Lentiviral Transduction Particles
EGF-like repeats and discoidin I-like domains 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010103.4-1050s21c1
Sequence:CCGGTCCCTACTATGCTCGACTTAACTCGAGTTAAGTCGAGCATAGTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010103.4-859s21c1
Sequence:CCGGCCTTGCAGAAATGGCGGAATACTCGAGTATTCCGCCATTTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010103.4-2410s21c1
Sequence:CCGGTTGATATGCAGGACCATTAATCTCGAGATTAATGGTCCTGCATATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010103.4-773s21c1
Sequence:CCGGACACATTCATAGGCTATGTTTCTCGAGAAACATAGCCTATGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010103.4-968s21c1
Sequence:CCGGGAATCGAAGGTGGGATCATATCTCGAGATATGATCCCACCTTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005711
VALIDATED
EDIL3 MISSION shRNA Bacterial Glycerol Stock
EGF-like repeats and discoidin I-like domains 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1312s21c1
Sequence:CCGGCCCAAGTTTGTCGAAGACATTCTCGAGAATGTCTTCGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-683s21c1
Sequence:CCGGCTGTGAAATAAGTGAAGCATACTCGAGTATGCTTCACTTATTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-859s21c1
Sequence:CCGGGCGAATTTATGGGAAGAAATTCTCGAGAATTTCTTCCCATAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1290s21c1
Sequence:CCGGGCTCAGTATGTAAGACTCTATCTCGAGATAGAGTCTTACATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1767s21c1
Sequence:CCGGCCCATCTATGCACGACACATACTCGAGTATGTGTCGTGCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-1312s1c1
Sequence:CCGGCCCAAGTTTGTCGAAGACATTCTCGAGAATGTCTTCGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-859s1c1
Sequence:CCGGGCGAATTTATGGGAAGAAATTCTCGAGAATTTCTTCCCATAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-1290s1c1
Sequence:CCGGGCTCAGTATGTAAGACTCTATCTCGAGATAGAGTCTTACATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005711.3-683s1c1
Sequence:CCGGCTGTGAAATAAGTGAAGCATACTCGAGTATGCTTCACTTATTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005711.3-1767s1c1
Sequence:CCGGCCCATCTATGCACGACACATACTCGAGTATGTGTCGTGCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005711
VALIDATED
EDIL3 MISSION shRNA shRNA Plasmid DNA
EGF-like repeats and discoidin I-like domains 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1312s21c1
Sequence:CCGGCCCAAGTTTGTCGAAGACATTCTCGAGAATGTCTTCGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-683s21c1
Sequence:CCGGCTGTGAAATAAGTGAAGCATACTCGAGTATGCTTCACTTATTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-859s21c1
Sequence:CCGGGCGAATTTATGGGAAGAAATTCTCGAGAATTTCTTCCCATAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1290s21c1
Sequence:CCGGGCTCAGTATGTAAGACTCTATCTCGAGATAGAGTCTTACATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1767s21c1
Sequence:CCGGCCCATCTATGCACGACACATACTCGAGTATGTGTCGTGCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-1312s1c1
Sequence:CCGGCCCAAGTTTGTCGAAGACATTCTCGAGAATGTCTTCGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-859s1c1
Sequence:CCGGGCGAATTTATGGGAAGAAATTCTCGAGAATTTCTTCCCATAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-1290s1c1
Sequence:CCGGGCTCAGTATGTAAGACTCTATCTCGAGATAGAGTCTTACATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005711.3-683s1c1
Sequence:CCGGCTGTGAAATAAGTGAAGCATACTCGAGTATGCTTCACTTATTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005711.3-1767s1c1
Sequence:CCGGCCCATCTATGCACGACACATACTCGAGTATGTGTCGTGCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005711
VALIDATED
EDIL3 MISSION shRNA Lentiviral Transduction Particles
EGF-like repeats and discoidin I-like domains 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1312s21c1
Sequence:CCGGCCCAAGTTTGTCGAAGACATTCTCGAGAATGTCTTCGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-683s21c1
Sequence:CCGGCTGTGAAATAAGTGAAGCATACTCGAGTATGCTTCACTTATTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-859s21c1
Sequence:CCGGGCGAATTTATGGGAAGAAATTCTCGAGAATTTCTTCCCATAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1290s21c1
Sequence:CCGGGCTCAGTATGTAAGACTCTATCTCGAGATAGAGTCTTACATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005711.3-1767s21c1
Sequence:CCGGCCCATCTATGCACGACACATACTCGAGTATGTGTCGTGCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-1312s1c1
Sequence:CCGGCCCAAGTTTGTCGAAGACATTCTCGAGAATGTCTTCGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-859s1c1
Sequence:CCGGGCGAATTTATGGGAAGAAATTCTCGAGAATTTCTTCCCATAAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005711.3-1290s1c1
Sequence:CCGGGCTCAGTATGTAAGACTCTATCTCGAGATAGAGTCTTACATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005711.3-683s1c1
Sequence:CCGGCTGTGAAATAAGTGAAGCATACTCGAGTATGCTTCACTTATTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005711.3-1767s1c1
Sequence:CCGGCCCATCTATGCACGACACATACTCGAGTATGTGTCGTGCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127411
VALIDATED
EDIL3 MISSION shRNA Bacterial Glycerol Stock
EGF-like repeats and discoidin I-like domains 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127411.3-1720s1c1
Sequence:CCGGGCCCACATTCTGTGCATTTAACTCGAGTTAAATGCACAGAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-760s1c1
Sequence:CCGGACACATTCATAGGCTATGTTTCTCGAGAAACATAGCCTATGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-846s1c1
Sequence:CCGGCCTTGCAGAAATGGCGGAATACTCGAGTATTCCGCCATTTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127411.3-905s1c1
Sequence:CCGGAGGAGAATTTATGGGACGAAACTCGAGTTTCGTCCCATAAATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-1038s1c1
Sequence:CCGGCCCTACTATGCTCGACTTAATCTCGAGATTAAGTCGAGCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127411
VALIDATED
EDIL3 MISSION shRNA shRNA Plasmid DNA
EGF-like repeats and discoidin I-like domains 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127411.3-1720s1c1
Sequence:CCGGGCCCACATTCTGTGCATTTAACTCGAGTTAAATGCACAGAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-760s1c1
Sequence:CCGGACACATTCATAGGCTATGTTTCTCGAGAAACATAGCCTATGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-846s1c1
Sequence:CCGGCCTTGCAGAAATGGCGGAATACTCGAGTATTCCGCCATTTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127411.3-905s1c1
Sequence:CCGGAGGAGAATTTATGGGACGAAACTCGAGTTTCGTCCCATAAATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-1038s1c1
Sequence:CCGGCCCTACTATGCTCGACTTAATCTCGAGATTAAGTCGAGCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127411
VALIDATED
EDIL3 MISSION shRNA Lentiviral Transduction Particles
EGF-like repeats and discoidin I-like domains 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127411.3-1720s1c1
Sequence:CCGGGCCCACATTCTGTGCATTTAACTCGAGTTAAATGCACAGAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-760s1c1
Sequence:CCGGACACATTCATAGGCTATGTTTCTCGAGAAACATAGCCTATGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-846s1c1
Sequence:CCGGCCTTGCAGAAATGGCGGAATACTCGAGTATTCCGCCATTTCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127411.3-905s1c1
Sequence:CCGGAGGAGAATTTATGGGACGAAACTCGAGTTTCGTCCCATAAATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_127411.3-1038s1c1
Sequence:CCGGCCCTACTATGCTCGACTTAATCTCGAGATTAAGTCGAGCATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks