EMAIL THIS PAGE TO A FRIEND

EDN1

endothelin 1

Synonyms: ET1 HDLCQ7 PPET1
UniProtKB ID: P05305, Q96DA1
Gene ID:
Human(1906) Summary: The protein encoded by this gene is proteolytically processed to release a secreted peptide termed endothelin 1. This peptide is a potent vasoconstrictor and is produced by vascular endothelial cells. Endothelin 1 also can affect the central nervous system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Mouse(13614) endothelin 1
Rat(24323) endothelin 1
Zebrafish(58032) endothelin 1
cow(281137) endothelin 1
dog(403424) endothelin 1
Horse(100034060) endothelin 1
domestic cat(494214) endothelin 1
chicken(420854) endothelin 1
sheep(100294653) endothelin 1
sheep(443498) endothelin 1
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001955 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022331 MISSION® esiRNA esiRNA human EDN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001955 Rosetta Predictions human pricing
NM_012548 Rosetta Predictions rat pricing
NM_010104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234276 predicted 733
2 SASI_Hs01_00234278 predicted 391
3 SASI_Hs02_00332887 predicted 855
4 SASI_Hs01_00234279 predicted 836
5 SASI_Hs01_00234281 predicted 584
6 SASI_Hs02_00332888 predicted 794
7 SASI_Hs01_00234282 predicted 610
8 SASI_Hs02_00332889 predicted 730
9 SASI_Hs01_00234284 predicted 507
10 SASI_Hs02_00332890 predicted 389
11 SASI_Hs01_00234275 predicted 1079
12 SASI_Hs01_00234277 predicted 1034
13 SASI_Hs01_00234280 predicted 1015
14 SASI_Hs01_00234283 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078163 predicted 857
2 SASI_Rn01_00078164 predicted 440
3 SASI_Rn02_00259631 predicted 436
4 SASI_Rn01_00078168 predicted 471
5 SASI_Rn01_00078169 predicted 772
6 SASI_Rn02_00259632 predicted 555
7 SASI_Rn01_00078170 predicted 708
8 SASI_Rn01_00078171 predicted 817
9 SASI_Rn02_00259633 predicted 895
10 SASI_Rn01_00078172 predicted 983
11 SASI_Rn01_00078165 predicted 1006
12 SASI_Rn01_00078166 predicted 643
13 SASI_Rn01_00078167 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317807 predicted 1108
2 SASI_Mm01_00183926 predicted 807
3 SASI_Mm01_00183927 predicted 721
4 SASI_Mm01_00183929 predicted 778
5 SASI_Mm01_00183930 predicted 686
6 SASI_Mm01_00183931 predicted 1006
7 SASI_Mm01_00183932 predicted 1200
8 SASI_Mm01_00183933 predicted 1118
9 SASI_Mm01_00183934 predicted 683
10 SASI_Mm01_00183935 predicted 1270
11 SASI_Mm01_00183928 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010104
EDN1 MISSION shRNA Bacterial Glycerol Stock
endothelin 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010104.2-1735s1c1
Sequence:CCGGGCTGAAACATTGCCATGCTAACTCGAGTTAGCATGGCAATGTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-813s1c1
Sequence:CCGGGCCCAAAGTACCATGCAGAAACTCGAGTTTCTGCATGGTACTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-941s1c1
Sequence:CCGGCAATAGCATCAAGGCATCTTTCTCGAGAAAGATGCCTTGATGCTATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-696s1c1
Sequence:CCGGCGTTCCTTGAAAGACTTACTTCTCGAGAAGTAAGTCTTTCAAGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-581s1c1
Sequence:CCGGCTGTTCTTCCTTGATGGACAACTCGAGTTGTCCATCAAGGAAGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010104.3-1381s21c1
Sequence:CCGGGCATCCTTGATCCAAACATTCCTCGAGGAATGTTTGGATCAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010104.3-973s21c1
Sequence:CCGGAGACAAGAAGTGCTGGAATTTCTCGAGAAATTCCAGCACTTCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010104
EDN1 MISSION shRNA shRNA Plasmid DNA
endothelin 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010104.2-1735s1c1
Sequence:CCGGGCTGAAACATTGCCATGCTAACTCGAGTTAGCATGGCAATGTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-813s1c1
Sequence:CCGGGCCCAAAGTACCATGCAGAAACTCGAGTTTCTGCATGGTACTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-941s1c1
Sequence:CCGGCAATAGCATCAAGGCATCTTTCTCGAGAAAGATGCCTTGATGCTATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-696s1c1
Sequence:CCGGCGTTCCTTGAAAGACTTACTTCTCGAGAAGTAAGTCTTTCAAGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-581s1c1
Sequence:CCGGCTGTTCTTCCTTGATGGACAACTCGAGTTGTCCATCAAGGAAGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010104.3-1381s21c1
Sequence:CCGGGCATCCTTGATCCAAACATTCCTCGAGGAATGTTTGGATCAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010104.3-973s21c1
Sequence:CCGGAGACAAGAAGTGCTGGAATTTCTCGAGAAATTCCAGCACTTCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010104
EDN1 MISSION shRNA Lentiviral Transduction Particles
endothelin 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010104.2-1735s1c1
Sequence:CCGGGCTGAAACATTGCCATGCTAACTCGAGTTAGCATGGCAATGTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-813s1c1
Sequence:CCGGGCCCAAAGTACCATGCAGAAACTCGAGTTTCTGCATGGTACTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-941s1c1
Sequence:CCGGCAATAGCATCAAGGCATCTTTCTCGAGAAAGATGCCTTGATGCTATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-696s1c1
Sequence:CCGGCGTTCCTTGAAAGACTTACTTCTCGAGAAGTAAGTCTTTCAAGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010104.2-581s1c1
Sequence:CCGGCTGTTCTTCCTTGATGGACAACTCGAGTTGTCCATCAAGGAAGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010104.3-1381s21c1
Sequence:CCGGGCATCCTTGATCCAAACATTCCTCGAGGAATGTTTGGATCAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010104.3-973s21c1
Sequence:CCGGAGACAAGAAGTGCTGGAATTTCTCGAGAAATTCCAGCACTTCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001955
VALIDATED
EDN1 MISSION shRNA Bacterial Glycerol Stock
endothelin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001955.x-677s1c1
Sequence:CCGGGCAGTTAGTGAGAGGAAGAAACTCGAGTTTCTTCCTCTCACTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-609s1c1
Sequence:CCGGGAGAAAGACTGGAATAATCATCTCGAGATGATTATTCCAGTCTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001955.x-1298s1c1
Sequence:CCGGAGACAAACATGCAAGTAAAGACTCGAGTCTTTACTTGCATGTTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-525s1c1
Sequence:CCGGAGATGCCAATGTGCTAGCCAACTCGAGTTGGCTAGCACATTGGCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-548s1c1
Sequence:CCGGAGACAAGAAGTGCTGGAATTTCTCGAGAAATTCCAGCACTTCTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001955.3-498s21c1
Sequence:CCGGGCTCGTCCCTGATGGATAAAGCTCGAGCTTTATCCATCAGGGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001955.3-808s21c1
Sequence:CCGGGCAGTTAGTGAGAGGAAGAAACTCGAGTTTCTTCCTCTCACTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001955.3-876s21c1
Sequence:CCGGCCATGAGAAACAGCGTCAAATCTCGAGATTTGACGCTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001955.3-604s21c1
Sequence:CCGGCAAGAGAGCCTTGGAGAATTTCTCGAGAAATTCTCCAAGGCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001955.3-1429s21c1
Sequence:CCGGAGACAAACATGCAAGTAAAGACTCGAGTCTTTACTTGCATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001955
VALIDATED
EDN1 MISSION shRNA shRNA Plasmid DNA
endothelin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001955.x-677s1c1
Sequence:CCGGGCAGTTAGTGAGAGGAAGAAACTCGAGTTTCTTCCTCTCACTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-609s1c1
Sequence:CCGGGAGAAAGACTGGAATAATCATCTCGAGATGATTATTCCAGTCTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001955.x-1298s1c1
Sequence:CCGGAGACAAACATGCAAGTAAAGACTCGAGTCTTTACTTGCATGTTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-525s1c1
Sequence:CCGGAGATGCCAATGTGCTAGCCAACTCGAGTTGGCTAGCACATTGGCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-548s1c1
Sequence:CCGGAGACAAGAAGTGCTGGAATTTCTCGAGAAATTCCAGCACTTCTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001955.3-498s21c1
Sequence:CCGGGCTCGTCCCTGATGGATAAAGCTCGAGCTTTATCCATCAGGGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001955.3-808s21c1
Sequence:CCGGGCAGTTAGTGAGAGGAAGAAACTCGAGTTTCTTCCTCTCACTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001955.3-876s21c1
Sequence:CCGGCCATGAGAAACAGCGTCAAATCTCGAGATTTGACGCTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001955.3-604s21c1
Sequence:CCGGCAAGAGAGCCTTGGAGAATTTCTCGAGAAATTCTCCAAGGCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001955.3-1429s21c1
Sequence:CCGGAGACAAACATGCAAGTAAAGACTCGAGTCTTTACTTGCATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001955
VALIDATED
EDN1 MISSION shRNA Lentiviral Transduction Particles
endothelin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001955.x-677s1c1
Sequence:CCGGGCAGTTAGTGAGAGGAAGAAACTCGAGTTTCTTCCTCTCACTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-609s1c1
Sequence:CCGGGAGAAAGACTGGAATAATCATCTCGAGATGATTATTCCAGTCTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001955.x-1298s1c1
Sequence:CCGGAGACAAACATGCAAGTAAAGACTCGAGTCTTTACTTGCATGTTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-525s1c1
Sequence:CCGGAGATGCCAATGTGCTAGCCAACTCGAGTTGGCTAGCACATTGGCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001955.x-548s1c1
Sequence:CCGGAGACAAGAAGTGCTGGAATTTCTCGAGAAATTCCAGCACTTCTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001955.3-498s21c1
Sequence:CCGGGCTCGTCCCTGATGGATAAAGCTCGAGCTTTATCCATCAGGGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001955.3-808s21c1
Sequence:CCGGGCAGTTAGTGAGAGGAAGAAACTCGAGTTTCTTCCTCTCACTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001955.3-876s21c1
Sequence:CCGGCCATGAGAAACAGCGTCAAATCTCGAGATTTGACGCTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001955.3-604s21c1
Sequence:CCGGCAAGAGAGCCTTGGAGAATTTCTCGAGAAATTCTCCAAGGCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001955.3-1429s21c1
Sequence:CCGGAGACAAACATGCAAGTAAAGACTCGAGTCTTTACTTGCATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks