EMAIL THIS PAGE TO A FRIEND

EDN2

endothelin 2

76 Gene Product Result for
Synonyms: ET2 PPET2
UniProtKB ID: P20800, Q5T1R3
Gene ID:
Human(1907) Summary: This gene encodes a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling events. This gene product is involved in a wide range of biological processes, such as hypertension and ovulation. [provided by RefSeq, Oct 2008]
Mouse(13615) endothelin 2
Rat(24324) endothelin 2
sheep(101103933) endothelin 2
Zebrafish(569550) endothelin 2
cow(319094) endothelin 2
Horse(100033847) endothelin 2
domestic cat(494215) endothelin 2
dog(403508) endothelin 2
chicken(419559) endothelin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039571 MISSION® esiRNA esiRNA human EDN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001956 Rosetta Predictions human pricing
NM_012549 Rosetta Predictions rat pricing
NM_007902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095198 predicted 685
2 SASI_Hs01_00095199 predicted 731
3 SASI_Hs01_00095200 predicted 558
4 SASI_Hs01_00095201 predicted 213
5 SASI_Hs01_00095202 predicted 249
6 SASI_Hs01_00095203 predicted 461
7 SASI_Hs01_00095204 predicted 445
8 SASI_Hs01_00095205 predicted 879
9 SASI_Hs01_00095206 predicted 200
10 SASI_Hs02_00332891 predicted 351
11 SASI_Hs01_00095207 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118046 predicted 861
2 SASI_Rn01_00118047 predicted 943
3 SASI_Rn01_00118048 predicted 869
4 SASI_Rn01_00118049 predicted 974
5 SASI_Rn01_00118050 predicted 732
6 SASI_Rn01_00118051 predicted 454
7 SASI_Rn01_00118053 predicted 719
8 SASI_Rn01_00118054 predicted 237
9 SASI_Rn01_00118055 predicted 906
10 SASI_Rn02_00259634 predicted 643
11 SASI_Rn01_00118052 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034140 predicted 875
2 SASI_Mm01_00034141 predicted 837
3 SASI_Mm01_00034142 predicted 389
4 SASI_Mm01_00034143 predicted 481
5 SASI_Mm01_00034144 predicted 567
6 SASI_Mm01_00034145 predicted 913
7 SASI_Mm01_00034146 predicted 237
8 SASI_Mm01_00034147 predicted 226
9 SASI_Mm02_00312701 predicted 931
10 SASI_Mm01_00034148 predicted 219
11 SASI_Mm01_00034139 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007902
EDN2 MISSION shRNA Bacterial Glycerol Stock
endothelin 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007902.2-873s21c1
Sequence:CCGGGGAGCTATGTGAGGACAAATGCTCGAGCATTTGTCCTCACATAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007902.2-396s21c1
Sequence:CCGGGCTACCTTCTGCCATCGAAGACTCGAGTCTTCGATGGCAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007902.2-989s21c1
Sequence:CCGGAGACTGAACAGTCATCCTAATCTCGAGATTAGGATGACTGTTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007902.1-888s1c1
Sequence:CCGGGCTGACTGTATCTTACGGAATCTCGAGATTCCGTAAGATACAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-346s1c1
Sequence:CCGGCAAAGCGTTGTGAGTGCTCTACTCGAGTAGAGCACTCACAACGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-497s1c1
Sequence:CCGGCCTCCGAAAGCTGAGGGATATCTCGAGATATCCCTCAGCTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-233s1c1
Sequence:CCGGTGACAAGGAATGTGTGTACTTCTCGAGAAGTACACACATTCCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-455s1c1
Sequence:CCGGTGTGTTAAAGACTGGCAAGATCTCGAGATCTTGCCAGTCTTTAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007902
EDN2 MISSION shRNA shRNA Plasmid DNA
endothelin 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007902.2-873s21c1
Sequence:CCGGGGAGCTATGTGAGGACAAATGCTCGAGCATTTGTCCTCACATAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007902.2-396s21c1
Sequence:CCGGGCTACCTTCTGCCATCGAAGACTCGAGTCTTCGATGGCAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007902.2-989s21c1
Sequence:CCGGAGACTGAACAGTCATCCTAATCTCGAGATTAGGATGACTGTTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007902.1-888s1c1
Sequence:CCGGGCTGACTGTATCTTACGGAATCTCGAGATTCCGTAAGATACAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-346s1c1
Sequence:CCGGCAAAGCGTTGTGAGTGCTCTACTCGAGTAGAGCACTCACAACGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-497s1c1
Sequence:CCGGCCTCCGAAAGCTGAGGGATATCTCGAGATATCCCTCAGCTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-233s1c1
Sequence:CCGGTGACAAGGAATGTGTGTACTTCTCGAGAAGTACACACATTCCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-455s1c1
Sequence:CCGGTGTGTTAAAGACTGGCAAGATCTCGAGATCTTGCCAGTCTTTAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007902
EDN2 MISSION shRNA Lentiviral Transduction Particles
endothelin 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007902.2-873s21c1
Sequence:CCGGGGAGCTATGTGAGGACAAATGCTCGAGCATTTGTCCTCACATAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007902.2-396s21c1
Sequence:CCGGGCTACCTTCTGCCATCGAAGACTCGAGTCTTCGATGGCAGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007902.2-989s21c1
Sequence:CCGGAGACTGAACAGTCATCCTAATCTCGAGATTAGGATGACTGTTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007902.1-888s1c1
Sequence:CCGGGCTGACTGTATCTTACGGAATCTCGAGATTCCGTAAGATACAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-346s1c1
Sequence:CCGGCAAAGCGTTGTGAGTGCTCTACTCGAGTAGAGCACTCACAACGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-497s1c1
Sequence:CCGGCCTCCGAAAGCTGAGGGATATCTCGAGATATCCCTCAGCTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-233s1c1
Sequence:CCGGTGACAAGGAATGTGTGTACTTCTCGAGAAGTACACACATTCCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007902.1-455s1c1
Sequence:CCGGTGTGTTAAAGACTGGCAAGATCTCGAGATCTTGCCAGTCTTTAACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001956
EDN2 MISSION shRNA Bacterial Glycerol Stock
endothelin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-458s21c1
Sequence:CCGGACGTGTTCCAGACTGGCAAGACTCGAGTCTTGCCAGTCTGGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-503s21c1
Sequence:CCGGTCCAAAGGCTGAGGGACATTTCTCGAGAAATGTCCCTCAGCCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-257s21c1
Sequence:CCGGTCTGCCACTTGGACATCATCTCTCGAGAGATGATGTCCAAGTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001956.3-612s21c1
Sequence:CCGGTCGTGAGCTGGAGGAACATTGCTCGAGCAATGTTCCTCCAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-537s21c1
Sequence:CCGGCCTCTTTGCCAAGCGACAACACTCGAGTGTTGTCGCTTGGCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001956
EDN2 MISSION shRNA shRNA Plasmid DNA
endothelin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-458s21c1
Sequence:CCGGACGTGTTCCAGACTGGCAAGACTCGAGTCTTGCCAGTCTGGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-503s21c1
Sequence:CCGGTCCAAAGGCTGAGGGACATTTCTCGAGAAATGTCCCTCAGCCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-257s21c1
Sequence:CCGGTCTGCCACTTGGACATCATCTCTCGAGAGATGATGTCCAAGTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001956.3-612s21c1
Sequence:CCGGTCGTGAGCTGGAGGAACATTGCTCGAGCAATGTTCCTCCAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-537s21c1
Sequence:CCGGCCTCTTTGCCAAGCGACAACACTCGAGTGTTGTCGCTTGGCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001956
EDN2 MISSION shRNA Lentiviral Transduction Particles
endothelin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-458s21c1
Sequence:CCGGACGTGTTCCAGACTGGCAAGACTCGAGTCTTGCCAGTCTGGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-503s21c1
Sequence:CCGGTCCAAAGGCTGAGGGACATTTCTCGAGAAATGTCCCTCAGCCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-257s21c1
Sequence:CCGGTCTGCCACTTGGACATCATCTCTCGAGAGATGATGTCCAAGTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001956.3-612s21c1
Sequence:CCGGTCGTGAGCTGGAGGAACATTGCTCGAGCAATGTTCCTCCAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001956.3-537s21c1
Sequence:CCGGCCTCTTTGCCAAGCGACAACACTCGAGTGTTGTCGCTTGGCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks