EMAIL THIS PAGE TO A FRIEND

EDN3

endothelin 3

138 Gene Product Result for
Synonyms: ET-3 ET3 HSCR4 PPET3 WS4B
UniProtKB ID: P14138, E1P5I5, Q03229, Q7Z6D2, Q9UGT7
Gene ID:
Human(1908) Summary: The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Four alternatively spliced transcript variants encoding three distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(13616) endothelin 3
Rat(366270) endothelin 3
chicken(768509) endothelin 3
dog(403406) endothelin 3
Horse(100034064) endothelin 3
cow(513753) endothelin 3
sheep(101114458) endothelin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000114 Rosetta Predictions human pricing
NM_207032 Rosetta Predictions human pricing
NM_207033 Rosetta Predictions human pricing
NM_207034 Rosetta Predictions human pricing
NM_001077650 Rosetta Predictions rat pricing
NM_007903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225075 predicted 1526
2 SASI_Hs01_00225076 predicted 1361
3 SASI_Hs01_00225077 predicted 1542
4 SASI_Hs01_00225078 predicted 1540
5 SASI_Hs01_00225079 predicted 1338
6 SASI_Hs01_00225080 predicted 1331
7 SASI_Hs01_00225081 predicted 676
8 SASI_Hs01_00225082 predicted 1567
9 SASI_Hs01_00225083 predicted 1374
10 SASI_Hs01_00225084 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373714 predicted 1458
2 SASI_Hs01_00137391 predicted 1490
3 SASI_Hs01_00137392 predicted 1178
4 SASI_Hs01_00137393 predicted 1448
5 SASI_Hs01_00137394 predicted 895
6 SASI_Hs01_00137395 predicted 1477
7 SASI_Hs01_00137396 predicted 1453
8 SASI_Hs01_00137397 predicted 907
9 SASI_Hs01_00137398 predicted 976
10 SASI_Hs01_00137399 predicted 726
11 SASI_Hs01_00137400 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017074 predicted 1537
2 SASI_Hs01_00017075 predicted 1517
3 SASI_Hs02_00373715 predicted 1387
4 SASI_Hs02_00373716 predicted 1406
5 SASI_Hs01_00017077 predicted 1096
6 SASI_Hs01_00017078 predicted 1373
7 SASI_Hs01_00017079 predicted 1458
8 SASI_Hs01_00017081 predicted 1376
9 SASI_Hs02_00373717 predicted 1408
10 SASI_Hs02_00373718 predicted 1517
11 SASI_Hs01_00017076 predicted 1355
12 SASI_Hs01_00017080 predicted 1411
13 SASI_Hs01_00017082 predicted 1084
14 SASI_Hs01_00017083 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090297 predicted 1579
2 SASI_Hs01_00090298 predicted 1553
3 SASI_Hs02_00373719 predicted 1429
4 SASI_Hs02_00373720 predicted 1447
5 SASI_Hs01_00090300 predicted 1139
6 SASI_Hs01_00090301 predicted 1415
7 SASI_Hs01_00090302 predicted 1501
8 SASI_Hs01_00090304 predicted 1423
9 SASI_Hs01_00090305 predicted 902
10 SASI_Hs02_00373721 predicted 1450
11 SASI_Hs01_00090299 predicted 1388
12 SASI_Hs01_00090303 predicted 1445
13 SASI_Hs01_00090306 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207732 predicted 501
2 SASI_Rn02_00207733 predicted 317
3 SASI_Rn02_00207734 predicted 406
4 SASI_Rn02_00207735 predicted 323
5 SASI_Rn02_00207736 predicted 386
6 SASI_Rn02_00207737 predicted 500
7 SASI_Rn02_00207738 predicted 399
8 SASI_Rn02_00207739 predicted 321
9 SASI_Rn02_00207740 predicted 327
10 SASI_Rn02_00207741 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201100 predicted 1256
2 SASI_Mm01_00201101 predicted 727
3 SASI_Mm01_00201102 predicted 982
4 SASI_Mm01_00201103 predicted 1145
5 SASI_Mm01_00201104 predicted 981
6 SASI_Mm01_00201105 predicted 999
7 SASI_Mm01_00201106 predicted 797
8 SASI_Mm01_00201107 predicted 856
9 SASI_Mm01_00201108 predicted 1131
10 SASI_Mm01_00201109 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007903
EDN3 MISSION shRNA Bacterial Glycerol Stock
endothelin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007903.2-1379s1c1
Sequence:CCGGGCTGGGCAGTAGTCTATGAAACTCGAGTTTCATAGACTACTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-719s1c1
Sequence:CCGGGCACCAGAGATGTCACCAGTTCTCGAGAACTGGTGACATCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-722s1c1
Sequence:CCGGCCAGAGATGTCACCAGTTATTCTCGAGAATAACTGGTGACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-794s1c1
Sequence:CCGGCACGTCAAAGGTTGATGTCAACTCGAGTTGACATCAACCTTTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-488s1c1
Sequence:CCGGCGTGCTTCACTTACAAGGACACTCGAGTGTCCTTGTAAGTGAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007903
EDN3 MISSION shRNA shRNA Plasmid DNA
endothelin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007903.2-1379s1c1
Sequence:CCGGGCTGGGCAGTAGTCTATGAAACTCGAGTTTCATAGACTACTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-719s1c1
Sequence:CCGGGCACCAGAGATGTCACCAGTTCTCGAGAACTGGTGACATCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-722s1c1
Sequence:CCGGCCAGAGATGTCACCAGTTATTCTCGAGAATAACTGGTGACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-794s1c1
Sequence:CCGGCACGTCAAAGGTTGATGTCAACTCGAGTTGACATCAACCTTTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-488s1c1
Sequence:CCGGCGTGCTTCACTTACAAGGACACTCGAGTGTCCTTGTAAGTGAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007903
EDN3 MISSION shRNA Lentiviral Transduction Particles
endothelin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007903.2-1379s1c1
Sequence:CCGGGCTGGGCAGTAGTCTATGAAACTCGAGTTTCATAGACTACTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-719s1c1
Sequence:CCGGGCACCAGAGATGTCACCAGTTCTCGAGAACTGGTGACATCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-722s1c1
Sequence:CCGGCCAGAGATGTCACCAGTTATTCTCGAGAATAACTGGTGACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-794s1c1
Sequence:CCGGCACGTCAAAGGTTGATGTCAACTCGAGTTGACATCAACCTTTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007903.2-488s1c1
Sequence:CCGGCGTGCTTCACTTACAAGGACACTCGAGTGTCCTTGTAAGTGAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000114
EDN3 MISSION shRNA Bacterial Glycerol Stock
endothelin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000114.2-1480s1c1
Sequence:CCGGCCTTGATGTTTGTGACAAGAACTCGAGTTCTTGTCACAAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-958s1c1
Sequence:CCGGGTTGAAGTCAAGGACCAACAACTCGAGTTGTTGGTCCTTGACTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-911s1c1
Sequence:CCGGGTAATTCAAGGACGGCAGAAACTCGAGTTTCTGCCGTCCTTGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-746s1c1
Sequence:CCGGCCTATGGACTGTCCAACTACACTCGAGTGTAGTTGGACAGTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-680s1c1
Sequence:CCGGACAAGGAGTGTGTCTACTATTCTCGAGAATAGTAGACACACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000114.2-658s21c1
Sequence:CCGGTGCACGTGCTTCACCTACAAGCTCGAGCTTGTAGGTGAAGCACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000114.2-1229s21c1
Sequence:CCGGCATGTCCATCTTGTAATAAATCTCGAGATTTATTACAAGATGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000114.2-1357s21c1
Sequence:CCGGCATAGCTCTACAGGAGTTTATCTCGAGATAAACTCCTGTAGAGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000114
EDN3 MISSION shRNA shRNA Plasmid DNA
endothelin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000114.2-1480s1c1
Sequence:CCGGCCTTGATGTTTGTGACAAGAACTCGAGTTCTTGTCACAAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-958s1c1
Sequence:CCGGGTTGAAGTCAAGGACCAACAACTCGAGTTGTTGGTCCTTGACTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-911s1c1
Sequence:CCGGGTAATTCAAGGACGGCAGAAACTCGAGTTTCTGCCGTCCTTGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-746s1c1
Sequence:CCGGCCTATGGACTGTCCAACTACACTCGAGTGTAGTTGGACAGTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-680s1c1
Sequence:CCGGACAAGGAGTGTGTCTACTATTCTCGAGAATAGTAGACACACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000114.2-658s21c1
Sequence:CCGGTGCACGTGCTTCACCTACAAGCTCGAGCTTGTAGGTGAAGCACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000114.2-1229s21c1
Sequence:CCGGCATGTCCATCTTGTAATAAATCTCGAGATTTATTACAAGATGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000114.2-1357s21c1
Sequence:CCGGCATAGCTCTACAGGAGTTTATCTCGAGATAAACTCCTGTAGAGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000114
EDN3 MISSION shRNA Lentiviral Transduction Particles
endothelin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000114.2-1480s1c1
Sequence:CCGGCCTTGATGTTTGTGACAAGAACTCGAGTTCTTGTCACAAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-958s1c1
Sequence:CCGGGTTGAAGTCAAGGACCAACAACTCGAGTTGTTGGTCCTTGACTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-911s1c1
Sequence:CCGGGTAATTCAAGGACGGCAGAAACTCGAGTTTCTGCCGTCCTTGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-746s1c1
Sequence:CCGGCCTATGGACTGTCCAACTACACTCGAGTGTAGTTGGACAGTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000114.2-680s1c1
Sequence:CCGGACAAGGAGTGTGTCTACTATTCTCGAGAATAGTAGACACACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000114.2-658s21c1
Sequence:CCGGTGCACGTGCTTCACCTACAAGCTCGAGCTTGTAGGTGAAGCACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000114.2-1229s21c1
Sequence:CCGGCATGTCCATCTTGTAATAAATCTCGAGATTTATTACAAGATGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000114.2-1357s21c1
Sequence:CCGGCATAGCTCTACAGGAGTTTATCTCGAGATAAACTCCTGTAGAGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks