EMAIL THIS PAGE TO A FRIEND

EDNRA

endothelin receptor type A

84 Gene Product Result for
Synonyms: ET-A ETA ETA-R ETAR ETRA hET-AR
Gene ID:
Human(1909) Summary: This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(13617) endothelin receptor type A
Rat(24326) endothelin receptor type A
chicken(373908) endothelin receptor type A
cow(281749) endothelin receptor type A
Horse(100062644) endothelin receptor type A
domestic cat(101083419) endothelin receptor type A
dog(450187) endothelin receptor type A
domestic guinea pig(100723122) endothelin receptor type A
sheep(443465) endothelin receptor type A
Domestic Rabbit(100126073) endothelin receptor type A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001957 Rosetta Predictions human pricing
NM_012550 Rosetta Predictions rat pricing
NM_010332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083200 predicted 842
2 SASI_Hs01_00083201 predicted 1702
3 SASI_Hs01_00083202 predicted 1962
4 SASI_Hs01_00083203 predicted 1742
5 SASI_Hs02_00332892 predicted 1760
6 SASI_Hs01_00083204 predicted 1516
7 SASI_Hs01_00083205 predicted 885
8 SASI_Hs01_00083207 predicted 1220
9 SASI_Hs01_00083208 predicted 936
10 SASI_Hs01_00083209 predicted 978
11 SASI_Hs01_00083206 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259635 predicted 1212
2 SASI_Rn01_00070203 predicted 1343
3 SASI_Rn01_00070205 predicted 894
4 SASI_Rn01_00070206 predicted 882
5 SASI_Rn01_00070208 predicted 1278
6 SASI_Rn02_00259636 predicted 514
7 SASI_Rn01_00070209 predicted 491
8 SASI_Rn01_00070210 predicted 944
9 SASI_Rn02_00259637 predicted 370
10 SASI_Rn02_00259638 predicted 483
11 SASI_Rn01_00070204 predicted 417
12 SASI_Rn01_00070207 predicted 294
13 SASI_Rn01_00070211 predicted 1121
14 SASI_Rn01_00070212 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172819 predicted 1487
2 SASI_Mm01_00172820 predicted 709
3 SASI_Mm02_00318339 predicted 1298
4 SASI_Mm01_00172821 predicted 608
5 SASI_Mm01_00172822 predicted 1694
6 SASI_Mm01_00172823 predicted 1060
7 SASI_Mm01_00172824 predicted 1396
8 SASI_Mm01_00172825 predicted 842
9 SASI_Mm01_00172826 predicted 1005
10 SASI_Mm01_00172827 predicted 699
11 SASI_Mm01_00172828 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010332
EDNRA MISSION shRNA Bacterial Glycerol Stock
endothelin receptor type A
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000446185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010332.2-1866s21c1
Sequence:CCGGGCTATAGCCAATGGGTCTTTCCTCGAGGAAAGACCCATTGGCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010332.2-1503s21c1
Sequence:CCGGTAAACCCAATAGCTCTATATTCTCGAGAATATAGAGCTATTGGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010332
EDNRA MISSION shRNA shRNA Plasmid DNA
endothelin receptor type A
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000446185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010332.2-1866s21c1
Sequence:CCGGGCTATAGCCAATGGGTCTTTCCTCGAGGAAAGACCCATTGGCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010332.2-1503s21c1
Sequence:CCGGTAAACCCAATAGCTCTATATTCTCGAGAATATAGAGCTATTGGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010332
EDNRA MISSION shRNA Lentiviral Transduction Particles
endothelin receptor type A
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000446185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010332.2-1866s21c1
Sequence:CCGGGCTATAGCCAATGGGTCTTTCCTCGAGGAAAGACCCATTGGCTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010332.2-1503s21c1
Sequence:CCGGTAAACCCAATAGCTCTATATTCTCGAGAATATAGAGCTATTGGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001957
VALIDATED
EDNRA MISSION shRNA Bacterial Glycerol Stock
endothelin receptor type A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1462s21c1
Sequence:CCGGGGTGGCTCTTCGGGTTCTATTCTCGAGAATAGAACCCGAAGAGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001957.2-842s21c1
Sequence:CCGGCACTCATCAACCCACTAATTTCTCGAGAAATTAGTGGGTTGATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1739s21c1
Sequence:CCGGCATGGATTACATCGGTATTAACTCGAGTTAATACCGATGTAATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001957.2-3832s21c1
Sequence:CCGGCCAGACAGATTGCTGATAATACTCGAGTATTATCAGCAATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1655s21c1
Sequence:CCGGTCTTCATTTAAGCCGTATATTCTCGAGAATATACGGCTTAAATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1141s21c1
Sequence:CCGGACAATGACTTTGGCGTATTTCCTCGAGGAAATACGCCAAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001957.2-995s21c1
Sequence:CCGGGCTCAGGATCATTTACCAGAACTCGAGTTCTGGTAAATGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-1501s1c1
Sequence:CCGGCCGATGTGAATTACTTAGTTTCTCGAGAAACTAAGTAATTCACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001957.1-787s1c1
Sequence:CCGGGCTCAGGATCATTTACCAGAACTCGAGTTCTGGTAAATGATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-1543s1c1
Sequence:CCGGCGGTATTAACTTGGCAACCATCTCGAGATGGTTGCCAAGTTAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-633s1c1
Sequence:CCGGCCACTCATCAACCCACTAATTCTCGAGAATTAGTGGGTTGATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001957.1-3626s1c1
Sequence:CCGGCCAGACAGATTGCTGATAATACTCGAGTATTATCAGCAATCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001957
VALIDATED
EDNRA MISSION shRNA shRNA Plasmid DNA
endothelin receptor type A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1462s21c1
Sequence:CCGGGGTGGCTCTTCGGGTTCTATTCTCGAGAATAGAACCCGAAGAGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001957.2-842s21c1
Sequence:CCGGCACTCATCAACCCACTAATTTCTCGAGAAATTAGTGGGTTGATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1739s21c1
Sequence:CCGGCATGGATTACATCGGTATTAACTCGAGTTAATACCGATGTAATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001957.2-3832s21c1
Sequence:CCGGCCAGACAGATTGCTGATAATACTCGAGTATTATCAGCAATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1655s21c1
Sequence:CCGGTCTTCATTTAAGCCGTATATTCTCGAGAATATACGGCTTAAATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1141s21c1
Sequence:CCGGACAATGACTTTGGCGTATTTCCTCGAGGAAATACGCCAAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001957.2-995s21c1
Sequence:CCGGGCTCAGGATCATTTACCAGAACTCGAGTTCTGGTAAATGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-1501s1c1
Sequence:CCGGCCGATGTGAATTACTTAGTTTCTCGAGAAACTAAGTAATTCACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001957.1-787s1c1
Sequence:CCGGGCTCAGGATCATTTACCAGAACTCGAGTTCTGGTAAATGATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-1543s1c1
Sequence:CCGGCGGTATTAACTTGGCAACCATCTCGAGATGGTTGCCAAGTTAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-633s1c1
Sequence:CCGGCCACTCATCAACCCACTAATTCTCGAGAATTAGTGGGTTGATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001957.1-3626s1c1
Sequence:CCGGCCAGACAGATTGCTGATAATACTCGAGTATTATCAGCAATCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001957
VALIDATED
EDNRA MISSION shRNA Lentiviral Transduction Particles
endothelin receptor type A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1462s21c1
Sequence:CCGGGGTGGCTCTTCGGGTTCTATTCTCGAGAATAGAACCCGAAGAGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001957.2-842s21c1
Sequence:CCGGCACTCATCAACCCACTAATTTCTCGAGAAATTAGTGGGTTGATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1739s21c1
Sequence:CCGGCATGGATTACATCGGTATTAACTCGAGTTAATACCGATGTAATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001957.2-3832s21c1
Sequence:CCGGCCAGACAGATTGCTGATAATACTCGAGTATTATCAGCAATCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1655s21c1
Sequence:CCGGTCTTCATTTAAGCCGTATATTCTCGAGAATATACGGCTTAAATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001957.2-1141s21c1
Sequence:CCGGACAATGACTTTGGCGTATTTCCTCGAGGAAATACGCCAAAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001957.2-995s21c1
Sequence:CCGGGCTCAGGATCATTTACCAGAACTCGAGTTCTGGTAAATGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-1501s1c1
Sequence:CCGGCCGATGTGAATTACTTAGTTTCTCGAGAAACTAAGTAATTCACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001957.1-787s1c1
Sequence:CCGGGCTCAGGATCATTTACCAGAACTCGAGTTCTGGTAAATGATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-1543s1c1
Sequence:CCGGCGGTATTAACTTGGCAACCATCTCGAGATGGTTGCCAAGTTAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001957.1-633s1c1
Sequence:CCGGCCACTCATCAACCCACTAATTCTCGAGAATTAGTGGGTTGATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001957.1-3626s1c1
Sequence:CCGGCCAGACAGATTGCTGATAATACTCGAGTATTATCAGCAATCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134499
EDNRA MISSION shRNA Bacterial Glycerol Stock
endothelin receptor type A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-509s1c1
Sequence:CCGGCGCTAATCTAAGCAGCCACATCTCGAGATGTGGCTGCTTAGATTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-722s1c1
Sequence:CCGGCGCAACTCTACTACGAATCATCTCGAGATGATTCGTAGTAGAGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1691s1c1
Sequence:CCGGCCACAAGGACAGCATGAACTACTCGAGTAGTTCATGCTGTCCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1472s1c1
Sequence:CCGGGCTAATGGATTACATCGGCATCTCGAGATGCCGATGTAATCCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1034s1c1
Sequence:CCGGCGCCATTGAAATCGTCTCCATCTCGAGATGGAGACGATTTCAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134499
EDNRA MISSION shRNA shRNA Plasmid DNA
endothelin receptor type A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-509s1c1
Sequence:CCGGCGCTAATCTAAGCAGCCACATCTCGAGATGTGGCTGCTTAGATTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-722s1c1
Sequence:CCGGCGCAACTCTACTACGAATCATCTCGAGATGATTCGTAGTAGAGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1691s1c1
Sequence:CCGGCCACAAGGACAGCATGAACTACTCGAGTAGTTCATGCTGTCCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1472s1c1
Sequence:CCGGGCTAATGGATTACATCGGCATCTCGAGATGCCGATGTAATCCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1034s1c1
Sequence:CCGGCGCCATTGAAATCGTCTCCATCTCGAGATGGAGACGATTTCAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134499
EDNRA MISSION shRNA Lentiviral Transduction Particles
endothelin receptor type A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-509s1c1
Sequence:CCGGCGCTAATCTAAGCAGCCACATCTCGAGATGTGGCTGCTTAGATTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-722s1c1
Sequence:CCGGCGCAACTCTACTACGAATCATCTCGAGATGATTCGTAGTAGAGTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1691s1c1
Sequence:CCGGCCACAAGGACAGCATGAACTACTCGAGTAGTTCATGCTGTCCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1472s1c1
Sequence:CCGGGCTAATGGATTACATCGGCATCTCGAGATGCCGATGTAATCCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134499.4-1034s1c1
Sequence:CCGGCGCCATTGAAATCGTCTCCATCTCGAGATGGAGACGATTTCAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks