EMAIL THIS PAGE TO A FRIEND

EDNRB

endothelin receptor type B

192 Gene Product Result for
Synonyms: ABCDS ET-B ET-BR ETB ETBR ETRB HSCR HSCR2 WS4A
Gene ID:
Human(1910) Summary: The protein encoded by this gene is a G protein-coupled receptor which activates a phosphatidylinositol-calcium second messenger system. Its ligand, endothelin, consists of a family of three potent vasoactive peptides: ET1, ET2, and ET3. Studies suggest that the multigenic disorder, Hirschsprung disease type 2, is due to mutations in the endothelin receptor type B gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(13618) endothelin receptor type B
Rat(50672) endothelin receptor type B
chicken(408082) endothelin receptor type B
cow(281750) endothelin receptor type B
Horse(100033875) endothelin receptor type B
domestic cat(101086531) endothelin receptor type B
dog(403862) endothelin receptor type B
Domestic Rabbit(100009477) endothelin receptor type B
domestic guinea pig(100725686) endothelin receptor type B
naked mole-rat(101711510) endothelin receptor type B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
E6877 [Ala1,3,11,15]-Endothelin 1 human, mouse, rat pricing
S6545 Sarafotoxin S6c ≥97% (HPLC) human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
B157 BQ-788 ≥95%, solid human, mouse, rat pricing
594687 α-Sexithiophene human, rat pricing
B150 BQ-123 ≥99%, lyophilized powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000115 Rosetta Predictions human pricing
NM_001122659 Rosetta Predictions human pricing
NM_003991 Rosetta Predictions human pricing
NM_017333 Rosetta Predictions rat pricing
NM_007904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064231 predicted 592
2 SASI_Hs01_00064232 predicted 1154
3 SASI_Hs01_00064233 predicted 879
4 SASI_Hs01_00064234 predicted 991
5 SASI_Hs02_00301899 predicted 583
6 SASI_Hs01_00064235 predicted 626
7 SASI_Hs01_00064236 predicted 973
8 SASI_Hs01_00064237 predicted 1001
9 SASI_Hs01_00064238 predicted 1181
10 SASI_Hs01_00064239 predicted 637
11 SASI_Hs01_00064240 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327146 predicted 610
2 SASI_Hs02_00327147 predicted 1174
3 SASI_Hs02_00327148 predicted 901
4 SASI_Hs02_00327149 predicted 1016
5 SASI_Hs02_00327150 predicted 615
6 SASI_Hs02_00327151 predicted 655
7 SASI_Hs02_00327152 predicted 993
8 SASI_Hs02_00327153 predicted 1033
9 SASI_Hs02_00327154 predicted 1198
10 SASI_Hs02_00327155 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117055 predicted 611
2 SASI_Hs02_00336693 predicted 2018
3 SASI_Hs01_00117056 predicted 1171
4 SASI_Hs02_00336694 predicted 814
5 SASI_Hs02_00336695 predicted 752
6 SASI_Hs02_00336696 predicted 710
7 SASI_Hs01_00117060 predicted 994
8 SASI_Hs01_00117063 predicted 663
9 SASI_Hs01_00117064 predicted 825
10 SASI_Hs02_00336697 predicted 723
11 SASI_Hs01_00117057 predicted 889
12 SASI_Hs01_00117058 predicted 999
13 SASI_Hs01_00117059 predicted 632
14 SASI_Hs01_00117061 predicted 1011
15 SASI_Hs01_00117062 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054898 predicted 852
2 SASI_Rn01_00054899 predicted 613
3 SASI_Rn01_00054900 predicted 641
4 SASI_Rn01_00054901 predicted 1385
5 SASI_Rn01_00054902 predicted 1633
6 SASI_Rn01_00054903 predicted 1361
7 SASI_Rn01_00054904 predicted 1175
8 SASI_Rn01_00054905 predicted 828
9 SASI_Rn01_00054906 predicted 681
10 SASI_Rn01_00054907 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312702 predicted 823
2 SASI_Mm01_00112880 predicted 579
3 SASI_Mm01_00112881 predicted 678
4 SASI_Mm01_00112882 predicted 491
5 SASI_Mm01_00112884 predicted 1132
6 SASI_Mm01_00112885 predicted 1357
7 SASI_Mm01_00112886 predicted 1322
8 SASI_Mm01_00112887 predicted 333
9 SASI_Mm01_00112888 predicted 1106
10 SASI_Mm01_00112889 predicted 813
11 SASI_Mm01_00112883 predicted 1508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007904
EDNRB MISSION shRNA Bacterial Glycerol Stock
endothelin receptor type B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1528s1c1
Sequence:CCGGGCAATAAATACAGCTCGTCTTCTCGAGAAGACGAGCTGTATTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1136s1c1
Sequence:CCGGCGGTATGCAGATTGCTTTGAACTCGAGTTCAAAGCAATCTGCATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1373s1c1
Sequence:CCGGCGCTCTGTATTTGGTGAGCAACTCGAGTTGCTCACCAAATACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-801s1c1
Sequence:CCGGGCTCTAAGTATTGACAGATATCTCGAGATATCTGTCAATACTTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-584s1c1
Sequence:CCGGGCTGCTAAGAATCATCTACAACTCGAGTTGTAGATGATTCTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007904
EDNRB MISSION shRNA shRNA Plasmid DNA
endothelin receptor type B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1528s1c1
Sequence:CCGGGCAATAAATACAGCTCGTCTTCTCGAGAAGACGAGCTGTATTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1136s1c1
Sequence:CCGGCGGTATGCAGATTGCTTTGAACTCGAGTTCAAAGCAATCTGCATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1373s1c1
Sequence:CCGGCGCTCTGTATTTGGTGAGCAACTCGAGTTGCTCACCAAATACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-801s1c1
Sequence:CCGGGCTCTAAGTATTGACAGATATCTCGAGATATCTGTCAATACTTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-584s1c1
Sequence:CCGGGCTGCTAAGAATCATCTACAACTCGAGTTGTAGATGATTCTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007904
EDNRB MISSION shRNA Lentiviral Transduction Particles
endothelin receptor type B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1528s1c1
Sequence:CCGGGCAATAAATACAGCTCGTCTTCTCGAGAAGACGAGCTGTATTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1136s1c1
Sequence:CCGGCGGTATGCAGATTGCTTTGAACTCGAGTTCAAAGCAATCTGCATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-1373s1c1
Sequence:CCGGCGCTCTGTATTTGGTGAGCAACTCGAGTTGCTCACCAAATACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-801s1c1
Sequence:CCGGGCTCTAAGTATTGACAGATATCTCGAGATATCTGTCAATACTTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007904.2-584s1c1
Sequence:CCGGGCTGCTAAGAATCATCTACAACTCGAGTTGTAGATGATTCTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000115
EDNRB MISSION shRNA Bacterial Glycerol Stock
endothelin receptor type B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-978s1c1
Sequence:CCGGCAAAGGAAGTTATCTGCGAATCTCGAGATTCGCAGATAACTTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000115.1-2336s1c1
Sequence:CCGGCCTCACAAAGAGAAATAGAATCTCGAGATTCTATTTCTCTTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-1327s1c1
Sequence:CCGGCTGTTGGTATTGGACTATATTCTCGAGAATATAGTCCAATACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-515s1c1
Sequence:CCGGCCATCGAGATCAAGGAGACTTCTCGAGAAGTCTCCTTGATCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-1488s1c1
Sequence:CCGGGCAGTCGTGCTTAAAGTTCAACTCGAGTTGAACTTTAAGCACGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000115.2-1659s21c1
Sequence:CCGGTATTTGCACAGCACACTATTACTCGAGTAATAGTGTGCTGTGCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000115.2-1527s21c1
Sequence:CCGGCAACTTCCGTTCCAGTAATAACTCGAGTTATTACTGGAACGGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000115.2-1323s21c1
Sequence:CCGGTCTGTTGGTATTGGACTATATCTCGAGATATAGTCCAATACCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000115
EDNRB MISSION shRNA shRNA Plasmid DNA
endothelin receptor type B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-978s1c1
Sequence:CCGGCAAAGGAAGTTATCTGCGAATCTCGAGATTCGCAGATAACTTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000115.1-2336s1c1
Sequence:CCGGCCTCACAAAGAGAAATAGAATCTCGAGATTCTATTTCTCTTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-1327s1c1
Sequence:CCGGCTGTTGGTATTGGACTATATTCTCGAGAATATAGTCCAATACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-515s1c1
Sequence:CCGGCCATCGAGATCAAGGAGACTTCTCGAGAAGTCTCCTTGATCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-1488s1c1
Sequence:CCGGGCAGTCGTGCTTAAAGTTCAACTCGAGTTGAACTTTAAGCACGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000115.2-1659s21c1
Sequence:CCGGTATTTGCACAGCACACTATTACTCGAGTAATAGTGTGCTGTGCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000115.2-1527s21c1
Sequence:CCGGCAACTTCCGTTCCAGTAATAACTCGAGTTATTACTGGAACGGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000115.2-1323s21c1
Sequence:CCGGTCTGTTGGTATTGGACTATATCTCGAGATATAGTCCAATACCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000115
EDNRB MISSION shRNA Lentiviral Transduction Particles
endothelin receptor type B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-978s1c1
Sequence:CCGGCAAAGGAAGTTATCTGCGAATCTCGAGATTCGCAGATAACTTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000115.1-2336s1c1
Sequence:CCGGCCTCACAAAGAGAAATAGAATCTCGAGATTCTATTTCTCTTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-1327s1c1
Sequence:CCGGCTGTTGGTATTGGACTATATTCTCGAGAATATAGTCCAATACCAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-515s1c1
Sequence:CCGGCCATCGAGATCAAGGAGACTTCTCGAGAAGTCTCCTTGATCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000115.1-1488s1c1
Sequence:CCGGGCAGTCGTGCTTAAAGTTCAACTCGAGTTGAACTTTAAGCACGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000115.2-1659s21c1
Sequence:CCGGTATTTGCACAGCACACTATTACTCGAGTAATAGTGTGCTGTGCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000115.2-1527s21c1
Sequence:CCGGCAACTTCCGTTCCAGTAATAACTCGAGTTATTACTGGAACGGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000115.2-1323s21c1
Sequence:CCGGTCTGTTGGTATTGGACTATATCTCGAGATATAGTCCAATACCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks