EMAIL THIS PAGE TO A FRIEND

EEA1

early endosome antigen 1

132 Gene Product Result for
Synonyms: MST105 MSTP105 ZFYVE2
UniProtKB ID: Q15075, Q14221
Gene ID:
Mouse(216238) early endosome antigen 1
Rat(314764) early endosome antigen 1
Zebrafish(492695) early endosome antigen 1
cow(516259) early endosome antigen 1
Horse(100064347) early endosome antigen 1
domestic cat(101088764) early endosome antigen 1
dog(475424) early endosome antigen 1
chicken(417896) early endosome antigen 1
sheep(101114003) early endosome antigen 1
domestic guinea pig(100727802) early endosome antigen 1
naked mole-rat(101720751) early endosome antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E3906 Anti-Early Endosomal Antigen 1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing
E4156 Anti-Early Endosomal Antigen 1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunofluorescence, western blot pricing
GW21443A Anti-EEA1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, western blot pricing
AV30074 Anti-EEA1 antibody produced in rabbit affinity isolated antibody mouse, bovine, horse, rabbit, human, rat, guinea pig, canine
western blot pricing
SAB2100649 Anti-EEA1 antibody produced in rabbit affinity isolated antibody , rabbit, horse, human
western blot pricing
SAB4300682 Anti-EEA1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
HPA038158 Anti-EEA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA038159 Anti-EEA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry, western blot pricing
E7659 Monoclonal Anti-EEA1 antibody produced in mouse ~1.0 mg/mL, clone EEA1-N19, purified immunoglobulin, buffered aqueous solution human, mouse, rat
immunofluorescence, immunoprecipitation, western blot pricing
E8034 Monoclonal Anti-EEA1 antibody produced in mouse ~1.0 mg/mL, clone EEA1-C33, purified immunoglobulin, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1404579 Monoclonal Anti-EEA1, (C-terminal) antibody produced in mouse clone 2G2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0320 AQUA Peptide YVQELQ[K] chicken, cow, dog, human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_125851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003566 Rosetta Predictions human pricing
NM_001108086 Rosetta Predictions rat pricing
NM_001001932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109125 predicted 1425
2 SASI_Hs02_00335871 predicted 2110
3 SASI_Hs01_00109126 predicted 3906
4 SASI_Hs02_00335872 predicted 2043
5 SASI_Hs01_00109128 predicted 2403
6 SASI_Hs01_00109129 predicted 1686
7 SASI_Hs01_00109130 predicted 3552
8 SASI_Hs01_00109131 predicted 355
9 SASI_Hs01_00109132 predicted 1420
10 SASI_Hs01_00109133 predicted 2604
11 SASI_Hs01_00109127 predicted 1209
12 SASI_Hs01_00109134 predicted 4389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235214 predicted 1119
2 SASI_Rn02_00235215 predicted 3347
3 SASI_Rn02_00235216 predicted 746
4 SASI_Rn02_00235217 predicted 4407
5 SASI_Rn02_00235218 predicted 2216
6 SASI_Rn02_00235219 predicted 2446
7 SASI_Rn02_00235220 predicted 3949
8 SASI_Rn02_00235221 predicted 1018
9 SASI_Rn02_00235222 predicted 2100
10 SASI_Rn02_00235223 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182731 predicted 1534
2 SASI_Mm01_00182732 predicted 3046
3 SASI_Mm01_00182733 predicted 3994
4 SASI_Mm01_00182734 predicted 4446
5 SASI_Mm01_00182735 predicted 4587
6 SASI_Mm01_00182736 predicted 1172
7 SASI_Mm01_00182737 predicted 4125
8 SASI_Mm01_00182738 predicted 2150
9 SASI_Mm01_00182739 predicted 2783
10 SASI_Mm01_00182740 predicted 3967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003566
VALIDATED
EEA1 MISSION shRNA Bacterial Glycerol Stock
early endosome antigen 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-847s21c1
Sequence:CCGGACGTCTGACAGAAGAATTAAACTCGAGTTTAATTCTTCTGTCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003566.3-4587s21c1
Sequence:CCGGGTTTGGACACTGGTTGCAATACTCGAGTATTGCAACCAGTGTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-3394s21c1
Sequence:CCGGAGCCACCAGGCAAGATCTTAACTCGAGTTAAGATCTTGCCTGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-1431s21c1
Sequence:CCGGAGCATCTAAAGGCGGAGTTTACTCGAGTAAACTCCGCCTTTAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003566.3-4611s21c1
Sequence:CCGGGACCAAATAGGAATTAGTATACTCGAGTATACTAATTCCTATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-328s21c1
Sequence:CCGGTTCATCAGCAACTCCTATAAACTCGAGTTTATAGGAGTTGCTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-3554s21c1
Sequence:CCGGCAATTGCAGGAGCGATGTAAACTCGAGTTTACATCGCTCCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-4713s1c1
Sequence:CCGGGCTTACTTCTTTCTCCTAAATCTCGAGATTTAGGAGAAAGAAGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-1313s1c1
Sequence:CCGGGCGGAGTTTAAGCAGCTACAACTCGAGTTGTAGCTGCTTAAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003566.1-3855s1c1
Sequence:CCGGCCATGCAGATTACAGCATTAACTCGAGTTAATGCTGTAATCTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003566.1-2517s1c1
Sequence:CCGGCCCTTGAAAGTATCAAGCAAACTCGAGTTTGCTTGATACTTTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-2790s1c1
Sequence:CCGGCCGCTATATTAGACTTGGAAACTCGAGTTTCCAAGTCTAATATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003566
VALIDATED
EEA1 MISSION shRNA shRNA Plasmid DNA
early endosome antigen 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-847s21c1
Sequence:CCGGACGTCTGACAGAAGAATTAAACTCGAGTTTAATTCTTCTGTCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003566.3-4587s21c1
Sequence:CCGGGTTTGGACACTGGTTGCAATACTCGAGTATTGCAACCAGTGTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-3394s21c1
Sequence:CCGGAGCCACCAGGCAAGATCTTAACTCGAGTTAAGATCTTGCCTGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-1431s21c1
Sequence:CCGGAGCATCTAAAGGCGGAGTTTACTCGAGTAAACTCCGCCTTTAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003566.3-4611s21c1
Sequence:CCGGGACCAAATAGGAATTAGTATACTCGAGTATACTAATTCCTATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-328s21c1
Sequence:CCGGTTCATCAGCAACTCCTATAAACTCGAGTTTATAGGAGTTGCTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-3554s21c1
Sequence:CCGGCAATTGCAGGAGCGATGTAAACTCGAGTTTACATCGCTCCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-4713s1c1
Sequence:CCGGGCTTACTTCTTTCTCCTAAATCTCGAGATTTAGGAGAAAGAAGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-1313s1c1
Sequence:CCGGGCGGAGTTTAAGCAGCTACAACTCGAGTTGTAGCTGCTTAAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003566.1-3855s1c1
Sequence:CCGGCCATGCAGATTACAGCATTAACTCGAGTTAATGCTGTAATCTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003566.1-2517s1c1
Sequence:CCGGCCCTTGAAAGTATCAAGCAAACTCGAGTTTGCTTGATACTTTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-2790s1c1
Sequence:CCGGCCGCTATATTAGACTTGGAAACTCGAGTTTCCAAGTCTAATATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003566
VALIDATED
EEA1 MISSION shRNA Lentiviral Transduction Particles
early endosome antigen 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-847s21c1
Sequence:CCGGACGTCTGACAGAAGAATTAAACTCGAGTTTAATTCTTCTGTCAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003566.3-4587s21c1
Sequence:CCGGGTTTGGACACTGGTTGCAATACTCGAGTATTGCAACCAGTGTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-3394s21c1
Sequence:CCGGAGCCACCAGGCAAGATCTTAACTCGAGTTAAGATCTTGCCTGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-1431s21c1
Sequence:CCGGAGCATCTAAAGGCGGAGTTTACTCGAGTAAACTCCGCCTTTAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003566.3-4611s21c1
Sequence:CCGGGACCAAATAGGAATTAGTATACTCGAGTATACTAATTCCTATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-328s21c1
Sequence:CCGGTTCATCAGCAACTCCTATAAACTCGAGTTTATAGGAGTTGCTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003566.3-3554s21c1
Sequence:CCGGCAATTGCAGGAGCGATGTAAACTCGAGTTTACATCGCTCCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-4713s1c1
Sequence:CCGGGCTTACTTCTTTCTCCTAAATCTCGAGATTTAGGAGAAAGAAGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-1313s1c1
Sequence:CCGGGCGGAGTTTAAGCAGCTACAACTCGAGTTGTAGCTGCTTAAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003566.1-3855s1c1
Sequence:CCGGCCATGCAGATTACAGCATTAACTCGAGTTAATGCTGTAATCTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003566.1-2517s1c1
Sequence:CCGGCCCTTGAAAGTATCAAGCAAACTCGAGTTTGCTTGATACTTTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003566.1-2790s1c1
Sequence:CCGGCCGCTATATTAGACTTGGAAACTCGAGTTTCCAAGTCTAATATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001932
VALIDATED
EEA1 MISSION shRNA Bacterial Glycerol Stock
early endosome antigen 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-1821s21c1
Sequence:GTACCGGAGCAAGTGTTACGTCAGATTGCTCGAGCAATCTGACGTAACACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-4004s21c1
Sequence:GTACCGGACTATGCAGGTCACAACATTACTCGAGTAATGTTGTGACCTGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-3215s21c1
Sequence:CCGGGCGCTTCAAGGAGAGGTTAAACTCGAGTTTAACCTCTCCTTGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-3527s21c1
Sequence:CCGGCAAGCCGCCAAAGCTAGTTTGCTCGAGCAAACTAGCTTTGGCGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-349s21c1
Sequence:CCGGTTCATCAGCAACTCCTATAAACTCGAGTTTATAGGAGTTGCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001932.3-1073s21c1
Sequence:CCGGGCTCATTTGGAGGCTACAATACTCGAGTATTGTAGCCTCCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-6530s21c1
Sequence:CCGGCACCGTTCCTCTTAACTATTACTCGAGTAATAGTTAAGAGGAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-2464s21c1
Sequence:GTACCGGAGACTTAGAAGGCCACATTAACTCGAGTTAATGTGGCCTTCTAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-4866s21c1
Sequence:GTACCGGTCTGGACGGCTCCTATCATTTCTCGAGAAATGATAGGAGCCGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001932
VALIDATED
EEA1 MISSION shRNA shRNA Plasmid DNA
early endosome antigen 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-1821s21c1
Sequence:GTACCGGAGCAAGTGTTACGTCAGATTGCTCGAGCAATCTGACGTAACACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-4004s21c1
Sequence:GTACCGGACTATGCAGGTCACAACATTACTCGAGTAATGTTGTGACCTGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-3215s21c1
Sequence:CCGGGCGCTTCAAGGAGAGGTTAAACTCGAGTTTAACCTCTCCTTGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-3527s21c1
Sequence:CCGGCAAGCCGCCAAAGCTAGTTTGCTCGAGCAAACTAGCTTTGGCGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-349s21c1
Sequence:CCGGTTCATCAGCAACTCCTATAAACTCGAGTTTATAGGAGTTGCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001932.3-1073s21c1
Sequence:CCGGGCTCATTTGGAGGCTACAATACTCGAGTATTGTAGCCTCCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-6530s21c1
Sequence:CCGGCACCGTTCCTCTTAACTATTACTCGAGTAATAGTTAAGAGGAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-2464s21c1
Sequence:GTACCGGAGACTTAGAAGGCCACATTAACTCGAGTTAATGTGGCCTTCTAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-4866s21c1
Sequence:GTACCGGTCTGGACGGCTCCTATCATTTCTCGAGAAATGATAGGAGCCGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001932
VALIDATED
EEA1 MISSION shRNA Lentiviral Transduction Particles
early endosome antigen 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-1821s21c1
Sequence:GTACCGGAGCAAGTGTTACGTCAGATTGCTCGAGCAATCTGACGTAACACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-4004s21c1
Sequence:GTACCGGACTATGCAGGTCACAACATTACTCGAGTAATGTTGTGACCTGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-3215s21c1
Sequence:CCGGGCGCTTCAAGGAGAGGTTAAACTCGAGTTTAACCTCTCCTTGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-3527s21c1
Sequence:CCGGCAAGCCGCCAAAGCTAGTTTGCTCGAGCAAACTAGCTTTGGCGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-349s21c1
Sequence:CCGGTTCATCAGCAACTCCTATAAACTCGAGTTTATAGGAGTTGCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001932.3-1073s21c1
Sequence:CCGGGCTCATTTGGAGGCTACAATACTCGAGTATTGTAGCCTCCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-6530s21c1
Sequence:CCGGCACCGTTCCTCTTAACTATTACTCGAGTAATAGTTAAGAGGAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-2464s21c1
Sequence:GTACCGGAGACTTAGAAGGCCACATTAACTCGAGTTAATGTGGCCTTCTAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001932.3-4866s21c1
Sequence:GTACCGGTCTGGACGGCTCCTATCATTTCTCGAGAAATGATAGGAGCCGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125851
EEA1 MISSION shRNA Bacterial Glycerol Stock
early endosome antigen 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-3038s1c1
Sequence:CCGGCTGCTGTATTAGATTTGGAAACTCGAGTTTCCAAATCTAATACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-2297s1c1
Sequence:CCGGCGCAGCTTGACATACAGATTACTCGAGTAATCTGTATGTCAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-4030s1c1
Sequence:CCGGGCGAAGCTGCATTCTGAAATACTCGAGTATTTCAGAATGCAGCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-491s1c1
Sequence:CCGGCCAGTGTGACTGGTTTCATATCTCGAGATATGAAACCAGTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-3830s1c1
Sequence:CCGGCGCACAAACAAGAAAGCATAACTCGAGTTATGCTTTCTTGTTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125851
EEA1 MISSION shRNA shRNA Plasmid DNA
early endosome antigen 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-3038s1c1
Sequence:CCGGCTGCTGTATTAGATTTGGAAACTCGAGTTTCCAAATCTAATACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-2297s1c1
Sequence:CCGGCGCAGCTTGACATACAGATTACTCGAGTAATCTGTATGTCAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-4030s1c1
Sequence:CCGGGCGAAGCTGCATTCTGAAATACTCGAGTATTTCAGAATGCAGCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-491s1c1
Sequence:CCGGCCAGTGTGACTGGTTTCATATCTCGAGATATGAAACCAGTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-3830s1c1
Sequence:CCGGCGCACAAACAAGAAAGCATAACTCGAGTTATGCTTTCTTGTTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125851
EEA1 MISSION shRNA Lentiviral Transduction Particles
early endosome antigen 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-3038s1c1
Sequence:CCGGCTGCTGTATTAGATTTGGAAACTCGAGTTTCCAAATCTAATACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-2297s1c1
Sequence:CCGGCGCAGCTTGACATACAGATTACTCGAGTAATCTGTATGTCAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-4030s1c1
Sequence:CCGGGCGAAGCTGCATTCTGAAATACTCGAGTATTTCAGAATGCAGCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-491s1c1
Sequence:CCGGCCAGTGTGACTGGTTTCATATCTCGAGATATGAAACCAGTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125851.4-3830s1c1
Sequence:CCGGCGCACAAACAAGAAAGCATAACTCGAGTTATGCTTTCTTGTTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks