EMAIL THIS PAGE TO A FRIEND

EED

embryonic ectoderm development

156 Gene Product Result for
Synonyms: HEED WAIT1
Gene ID:
Human(8726) Summary: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(13626) embryonic ectoderm development
Rat(293104) embryonic ectoderm development
Zebrafish(550463) embryonic ectoderm development
chicken(426381) embryonic ectoderm development
dog(476779) embryonic ectoderm development
cow(404183) embryonic ectoderm development
domestic cat(101094696) embryonic ectoderm development
naked mole-rat(101705385) embryonic ectoderm development
domestic guinea pig(100728793) embryonic ectoderm development
sheep(101113712) embryonic ectoderm development
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108517 Anti-EED affinity isolated antibody guinea pig, human, mouse, rabbit, zebrafish, pig, bovine, horse, canine, bovine
western blot pricing
GW10896A Anti-EED antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB1406713 Anti-EED antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108394 Anti-EED antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, human, rabbit
western blot pricing
AV38384 Anti-EED antibody produced in rabbit affinity isolated antibody bovine, horse, zebrafish, rat, guinea pig, human, mouse, rabbit
immunohistochemistry, western blot pricing
HPA061140 Anti-EED antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106374 Anti-EED antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, mouse, human, rabbit
ELISA, western blot pricing
SAB2106433 Anti-EED antibody produced in rabbit affinity isolated antibody human, rabbit, horse, guinea pig, rat
ELISA, western blot pricing
HPA060089 Anti-EED antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2104969 Anti-EED, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, mouse, human, guinea pig, rat, rabbit
western blot pricing
SAB2702184 Monoclonal Anti-EED antibody produced in mouse clone GT1679, affinity isolated antibody human
western blot pricing
SAB2702185 Monoclonal Anti-EED antibody produced in mouse clone GT671, affinity isolated antibody mouse, human, rat
western blot pricing
SAB1403003 Monoclonal Anti-EED, (C-terminal) antibody produced in mouse clone 3B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003797 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003797 Rosetta Predictions human pricing
NM_152991 Rosetta Predictions human pricing
NM_001106278 Rosetta Predictions rat pricing
NM_021876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336316 predicted 772
2 SASI_Hs02_00336317 predicted 1228
3 SASI_Hs01_00147052 predicted 751
4 SASI_Hs01_00147053 predicted 847
5 SASI_Hs01_00147054 predicted 1280
6 SASI_Hs01_00147055 predicted 1220
7 SASI_Hs01_00147056 predicted 571
8 SASI_Hs02_00336318 predicted 630
9 SASI_Hs01_00147057 predicted 560
10 SASI_Hs01_00147058 predicted 806
11 SASI_Hs01_00147059 predicted 768
12 SASI_Hs01_00147060 predicted 1220
13 SASI_Hs01_00147061 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366940 predicted 781
2 SASI_Hs02_00366941 predicted 1223
3 SASI_Hs01_00201697 predicted 748
4 SASI_Hs01_00201698 predicted 846
5 SASI_Hs01_00201699 predicted 1286
6 SASI_Hs01_00201700 predicted 1217
7 SASI_Hs01_00201701 predicted 573
8 SASI_Hs02_00366942 predicted 628
9 SASI_Hs01_00201702 predicted 564
10 SASI_Hs01_00201703 predicted 811
11 SASI_Hs01_00201704 predicted 764
12 SASI_Hs01_00201705 predicted 1223
13 SASI_Hs01_00201706 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217398 predicted 1218
2 SASI_Rn02_00217399 predicted 819
3 SASI_Rn02_00217400 predicted 1468
4 SASI_Rn02_00217401 predicted 720
5 SASI_Rn02_00217402 predicted 1558
6 SASI_Rn02_00217403 predicted 949
7 SASI_Rn02_00217404 predicted 1619
8 SASI_Rn02_00217405 predicted 1686
9 SASI_Rn02_00217406 predicted 912
10 SASI_Rn02_00217407 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050931 predicted 1493
2 SASI_Mm01_00050932 predicted 747
3 SASI_Mm01_00050934 predicted 836
4 SASI_Mm01_00050935 predicted 1585
5 SASI_Mm01_00050936 predicted 974
6 SASI_Mm01_00050937 predicted 1720
7 SASI_Mm01_00050938 predicted 800
8 SASI_Mm02_00326435 predicted 1816
9 SASI_Mm01_00050939 predicted 940
10 SASI_Mm01_00050940 predicted 1646
11 SASI_Mm01_00050933 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021876
VALIDATED
EED MISSION shRNA Bacterial Glycerol Stock
embryonic ectoderm development
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1834s1c1
Sequence:CCGGTCTTGCTAGTAAGGGCACATACTCGAGTATGTGCCCTTACTAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1685s1c1
Sequence:CCGGCGGCTATTCGACAAACCAGTTCTCGAGAACTGGTTTGTCGAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-803s1c1
Sequence:CCGGGAAGCAACAGAGTAACCTTATCTCGAGATAAGGTTACTCTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1378s1c1
Sequence:CCGGGTTGATTGTGTGCGATGGTTACTCGAGTAACCATCGCACACAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1530s1c1
Sequence:CCGGCCAGTGTGACATTTGGTACATCTCGAGATGTACCAAATGTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021876.3-614s21c1
Sequence:CCGGACGCCCACAAATACGCCAAATCTCGAGATTTGGCGTATTTGTGGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021876.3-921s21c1
Sequence:CCGGACACCAGCCACCCTCTATTAGCTCGAGCTAATAGAGGGTGGCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021876.3-1887s21c1
Sequence:CCGGGCTGAGCTGAATGTAGTGATGCTCGAGCATCACTACATTCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021876
VALIDATED
EED MISSION shRNA shRNA Plasmid DNA
embryonic ectoderm development
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1834s1c1
Sequence:CCGGTCTTGCTAGTAAGGGCACATACTCGAGTATGTGCCCTTACTAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1685s1c1
Sequence:CCGGCGGCTATTCGACAAACCAGTTCTCGAGAACTGGTTTGTCGAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-803s1c1
Sequence:CCGGGAAGCAACAGAGTAACCTTATCTCGAGATAAGGTTACTCTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1378s1c1
Sequence:CCGGGTTGATTGTGTGCGATGGTTACTCGAGTAACCATCGCACACAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1530s1c1
Sequence:CCGGCCAGTGTGACATTTGGTACATCTCGAGATGTACCAAATGTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021876.3-614s21c1
Sequence:CCGGACGCCCACAAATACGCCAAATCTCGAGATTTGGCGTATTTGTGGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021876.3-921s21c1
Sequence:CCGGACACCAGCCACCCTCTATTAGCTCGAGCTAATAGAGGGTGGCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021876.3-1887s21c1
Sequence:CCGGGCTGAGCTGAATGTAGTGATGCTCGAGCATCACTACATTCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021876
VALIDATED
EED MISSION shRNA Lentiviral Transduction Particles
embryonic ectoderm development
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1834s1c1
Sequence:CCGGTCTTGCTAGTAAGGGCACATACTCGAGTATGTGCCCTTACTAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1685s1c1
Sequence:CCGGCGGCTATTCGACAAACCAGTTCTCGAGAACTGGTTTGTCGAATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-803s1c1
Sequence:CCGGGAAGCAACAGAGTAACCTTATCTCGAGATAAGGTTACTCTGTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1378s1c1
Sequence:CCGGGTTGATTGTGTGCGATGGTTACTCGAGTAACCATCGCACACAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021876.1-1530s1c1
Sequence:CCGGCCAGTGTGACATTTGGTACATCTCGAGATGTACCAAATGTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021876.3-614s21c1
Sequence:CCGGACGCCCACAAATACGCCAAATCTCGAGATTTGGCGTATTTGTGGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021876.3-921s21c1
Sequence:CCGGACACCAGCCACCCTCTATTAGCTCGAGCTAATAGAGGGTGGCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021876.3-1887s21c1
Sequence:CCGGGCTGAGCTGAATGTAGTGATGCTCGAGCATCACTACATTCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003797
VALIDATED
EED MISSION shRNA Bacterial Glycerol Stock
embryonic ectoderm development
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1608s1c1
Sequence:CCGGGCAAACTTTATGTTTGGGATTCTCGAGAATCCCAAACATAAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1722s1c1
Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003797.2-986s1c1
Sequence:CCGGCCTATAACAATGCAGTGTATACTCGAGTATACACTGCATTGTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1491s1c1
Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1359s1c1
Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1491s21c1
Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003797.2-1834s21c1
Sequence:CCGGAGAATTAATGTATCTTGCTAGCTCGAGCTAGCAAGATACATTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1359s21c1
Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1722s21c1
Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-954s21c1
Sequence:CCGGCTGGATCTAGAGGCATAATTACTCGAGTAATTATGCCTCTAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1124s21c1
Sequence:GTACCGGGACACTCTGGTGGCAATATTTCTCGAGAAATATTGCCACCAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003797
VALIDATED
EED MISSION shRNA shRNA Plasmid DNA
embryonic ectoderm development
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1608s1c1
Sequence:CCGGGCAAACTTTATGTTTGGGATTCTCGAGAATCCCAAACATAAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1722s1c1
Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003797.2-986s1c1
Sequence:CCGGCCTATAACAATGCAGTGTATACTCGAGTATACACTGCATTGTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1491s1c1
Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1359s1c1
Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1491s21c1
Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003797.2-1834s21c1
Sequence:CCGGAGAATTAATGTATCTTGCTAGCTCGAGCTAGCAAGATACATTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1359s21c1
Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1722s21c1
Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-954s21c1
Sequence:CCGGCTGGATCTAGAGGCATAATTACTCGAGTAATTATGCCTCTAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1124s21c1
Sequence:GTACCGGGACACTCTGGTGGCAATATTTCTCGAGAAATATTGCCACCAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003797
VALIDATED
EED MISSION shRNA Lentiviral Transduction Particles
embryonic ectoderm development
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1608s1c1
Sequence:CCGGGCAAACTTTATGTTTGGGATTCTCGAGAATCCCAAACATAAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1722s1c1
Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003797.2-986s1c1
Sequence:CCGGCCTATAACAATGCAGTGTATACTCGAGTATACACTGCATTGTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1491s1c1
Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003797.2-1359s1c1
Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1491s21c1
Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003797.2-1834s21c1
Sequence:CCGGAGAATTAATGTATCTTGCTAGCTCGAGCTAGCAAGATACATTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1359s21c1
Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1722s21c1
Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-954s21c1
Sequence:CCGGCTGGATCTAGAGGCATAATTACTCGAGTAATTATGCCTCTAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003797.2-1124s21c1
Sequence:GTACCGGGACACTCTGGTGGCAATATTTCTCGAGAAATATTGCCACCAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks