EMAIL THIS PAGE TO A FRIEND

EEF1A1

eukaryotic translation elongation factor 1 alpha 1

87 Gene Product Result for
Synonyms: CCS-3 CCS3 EE1A1 EEF-1 EEF1A EF-Tu EF1A GRAF-1EF HNGC:16303 LENG7 PTI1 eEF1A-1
UniProtKB ID: P68104, P04719, P04720
Gene ID:
Human(1915) Summary: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. [provided by RefSeq, Jul 2008]
Mouse(13627) eukaryotic translation elongation factor 1 alpha 1
Rat(171361) eukaryotic translation elongation factor 1 alpha 1
chicken(373963) eukaryotic translation elongation factor 1 alpha 1
dog(608325) eukaryotic translation elongation factor 1 alpha 1
domestic cat(493922) eukaryotic translation elongation factor 1 alpha 1
cow(282220) eukaryotic translation elongation factor 1 alpha 1
Horse(100009682) eukaryotic translation elongation factor 1 alpha 1
dog(403506) eukaryotic translation elongation factor 1 alpha 1
Goat(100860780) eukaryotic translation elongation factor 1 alpha 1
Domestic Rabbit(100009189) eukaryotic translation elongation factor 1 alpha 1
sheep(678678) eukaryotic translation elongation factor 1 alpha 1
domestic guinea pig(100720380) eukaryotic translation elongation factor 1 alpha 1
naked mole-rat(101719918) eukaryotic translation elongation factor 1 alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001402 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001402 Rosetta Predictions human pricing
NM_175838 Rosetta Predictions rat pricing
NM_010106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331771 predicted 314
2 SASI_Hs02_00331772 predicted 1527
3 SASI_Hs02_00331773 predicted 262
4 SASI_Hs02_00331774 predicted 301
5 SASI_Hs02_00331775 predicted 900
6 SASI_Hs02_00331776 predicted 1513
7 SASI_Hs02_00331777 predicted 1502
8 SASI_Hs02_00331778 predicted 276
9 SASI_Hs02_00331779 predicted 695
10 SASI_Hs02_00331780 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269532 predicted 952
2 SASI_Rn01_00089631 predicted 988
3 SASI_Rn02_00269533 predicted 508
4 SASI_Rn02_00269534 predicted 1089
5 SASI_Rn01_00089633 predicted 561
6 SASI_Rn01_00089634 predicted 1202
7 SASI_Rn02_00269535 predicted 1183
8 SASI_Rn01_00089635 predicted 912
9 SASI_Rn02_00269536 predicted 321
10 SASI_Rn02_00269537 predicted 322
11 SASI_Rn01_00089632 predicted 562
12 SASI_Rn01_00089636 predicted 686
13 SASI_Rn01_00089637 predicted 94
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068955 predicted 755
2 SASI_Mm01_00068956 predicted 607
3 SASI_Mm02_00317808 predicted 811
4 SASI_Mm01_00068959 predicted 1248
5 SASI_Mm01_00068960 predicted 605
6 SASI_Mm01_00068962 predicted 1035
7 SASI_Mm02_00317809 predicted 668
8 SASI_Mm01_00068963 predicted 536
9 SASI_Mm01_00068958 predicted 556
10 SASI_Mm02_00317810 predicted 550
11 SASI_Mm01_00068954 predicted 641
12 SASI_Mm01_00068957 predicted 986
13 SASI_Mm01_00068961 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010106
VALIDATED
EEF1A1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 alpha 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-1264s21c1
Sequence:CCGGCGTTCTGGTAAGAAGCTGGAACTCGAGTTCCAGCTTCTTACCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-324s21c1
Sequence:CCGGGCGTGGTATCACTATTGACATCTCGAGATGTCAATAGTGATACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-964s21c1
Sequence:CCGGCCAGTCAATGTAACAACTGAACTCGAGTTCAGTTGTTACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010106.2-1534s21c1
Sequence:CCGGCCAGTCTTAATCAGTGGTGGACTCGAGTCCACCACTGATTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-1510s1c1
Sequence:CCGGCCAGTCTTAATCAGTGGTGGACTCGAGTCCACCACTGATTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-300s1c1
Sequence:CCGGGCGTGGTATCACTATTGACATCTCGAGATGTCAATAGTGATACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010106.1-445s1c1
Sequence:CCGGGCTGCTGGTGTTGGTGAATTTCTCGAGAAATTCACCAACACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-1240s1c1
Sequence:CCGGCGTTCTGGTAAGAAGCTGGAACTCGAGTTCCAGCTTCTTACCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-940s1c1
Sequence:CCGGCCAGTCAATGTAACAACTGAACTCGAGTTCAGTTGTTACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010106
VALIDATED
EEF1A1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 alpha 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-1264s21c1
Sequence:CCGGCGTTCTGGTAAGAAGCTGGAACTCGAGTTCCAGCTTCTTACCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-324s21c1
Sequence:CCGGGCGTGGTATCACTATTGACATCTCGAGATGTCAATAGTGATACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-964s21c1
Sequence:CCGGCCAGTCAATGTAACAACTGAACTCGAGTTCAGTTGTTACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010106.2-1534s21c1
Sequence:CCGGCCAGTCTTAATCAGTGGTGGACTCGAGTCCACCACTGATTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-1510s1c1
Sequence:CCGGCCAGTCTTAATCAGTGGTGGACTCGAGTCCACCACTGATTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-300s1c1
Sequence:CCGGGCGTGGTATCACTATTGACATCTCGAGATGTCAATAGTGATACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010106.1-445s1c1
Sequence:CCGGGCTGCTGGTGTTGGTGAATTTCTCGAGAAATTCACCAACACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-1240s1c1
Sequence:CCGGCGTTCTGGTAAGAAGCTGGAACTCGAGTTCCAGCTTCTTACCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-940s1c1
Sequence:CCGGCCAGTCAATGTAACAACTGAACTCGAGTTCAGTTGTTACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010106
VALIDATED
EEF1A1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 alpha 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-1264s21c1
Sequence:CCGGCGTTCTGGTAAGAAGCTGGAACTCGAGTTCCAGCTTCTTACCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-324s21c1
Sequence:CCGGGCGTGGTATCACTATTGACATCTCGAGATGTCAATAGTGATACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010106.2-964s21c1
Sequence:CCGGCCAGTCAATGTAACAACTGAACTCGAGTTCAGTTGTTACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010106.2-1534s21c1
Sequence:CCGGCCAGTCTTAATCAGTGGTGGACTCGAGTCCACCACTGATTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-1510s1c1
Sequence:CCGGCCAGTCTTAATCAGTGGTGGACTCGAGTCCACCACTGATTAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-300s1c1
Sequence:CCGGGCGTGGTATCACTATTGACATCTCGAGATGTCAATAGTGATACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010106.1-445s1c1
Sequence:CCGGGCTGCTGGTGTTGGTGAATTTCTCGAGAAATTCACCAACACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-1240s1c1
Sequence:CCGGCGTTCTGGTAAGAAGCTGGAACTCGAGTTCCAGCTTCTTACCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010106.1-940s1c1
Sequence:CCGGCCAGTCAATGTAACAACTGAACTCGAGTTCAGTTGTTACATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001402
VALIDATED
EEF1A1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001402.4-687s1c1
Sequence:CCGGCCTTGGTTCAAGGGATGGAAACTCGAGTTTCCATCCCTTGAACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-1257s1c1
Sequence:CCGGGCTGCCATTGTTGATATGGTTCTCGAGAACCATATCAACAATGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-338s1c1
Sequence:CCGGCCCAGGACACAGAGACTTTATCTCGAGATAAAGTCTCTGTGTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-807s1c1
Sequence:CCGGCCTCTCCAGGATGTCTACAAACTCGAGTTTGTAGACATCCTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-551s1c1
Sequence:CCGGCCAGAAGAGATATGAGGAAATCTCGAGATTTCCTCATATCTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001402
VALIDATED
EEF1A1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001402.4-687s1c1
Sequence:CCGGCCTTGGTTCAAGGGATGGAAACTCGAGTTTCCATCCCTTGAACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-1257s1c1
Sequence:CCGGGCTGCCATTGTTGATATGGTTCTCGAGAACCATATCAACAATGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-338s1c1
Sequence:CCGGCCCAGGACACAGAGACTTTATCTCGAGATAAAGTCTCTGTGTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-807s1c1
Sequence:CCGGCCTCTCCAGGATGTCTACAAACTCGAGTTTGTAGACATCCTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-551s1c1
Sequence:CCGGCCAGAAGAGATATGAGGAAATCTCGAGATTTCCTCATATCTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001402
VALIDATED
EEF1A1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001402.4-687s1c1
Sequence:CCGGCCTTGGTTCAAGGGATGGAAACTCGAGTTTCCATCCCTTGAACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-1257s1c1
Sequence:CCGGGCTGCCATTGTTGATATGGTTCTCGAGAACCATATCAACAATGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-338s1c1
Sequence:CCGGCCCAGGACACAGAGACTTTATCTCGAGATAAAGTCTCTGTGTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-807s1c1
Sequence:CCGGCCTCTCCAGGATGTCTACAAACTCGAGTTTGTAGACATCCTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001402.4-551s1c1
Sequence:CCGGCCAGAAGAGATATGAGGAAATCTCGAGATTTCCTCATATCTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks