EMAIL THIS PAGE TO A FRIEND

EEF1A2

eukaryotic translation elongation factor 1 alpha 2

53 Gene Product Result for
Synonyms: EEF1AL EF-1-alpha-2 EF1A HS1 STN STNL
UniProtKB ID: Q05639, B5BUF3, E1P5J1, P54266, Q0VGC7
Gene ID:
Human(1917) Summary: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(13628) eukaryotic translation elongation factor 1 alpha 2
Rat(24799) eukaryotic translation elongation factor 1 alpha 2
Zebrafish(436644) eukaryotic translation elongation factor 1 alpha 2
cow(515233) eukaryotic translation elongation factor 1 alpha 2
chicken(419244) eukaryotic translation elongation factor 1 alpha 2
Horse(100060464) eukaryotic translation elongation factor 1 alpha 2
domestic cat(101100798) eukaryotic translation elongation factor 1 alpha 2
sheep(101109898) eukaryotic translation elongation factor 1 alpha 2
Domestic Rabbit(100008677) eukaryotic translation elongation factor 1 alpha 2
naked mole-rat(101720731) eukaryotic translation elongation factor 1 alpha 2
domestic guinea pig(100731897) eukaryotic translation elongation factor 1 alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001958 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001958 Rosetta Predictions human pricing
NM_012660 Rosetta Predictions rat pricing
NM_007906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184602 predicted 602
2 SASI_Hs01_00184603 predicted 1071
3 SASI_Hs01_00184604 predicted 651
4 SASI_Hs01_00184605 predicted 647
5 SASI_Hs01_00184606 predicted 657
6 SASI_Hs01_00184607 predicted 275
7 SASI_Hs01_00184608 predicted 1219
8 SASI_Hs01_00184609 predicted 807
9 SASI_Hs01_00184610 predicted 246
10 SASI_Hs01_00184611 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064339 predicted 931
2 SASI_Rn02_00259912 predicted 566
3 SASI_Rn01_00064340 predicted 762
4 SASI_Rn01_00064341 predicted 934
5 SASI_Rn01_00064343 predicted 343
6 SASI_Rn01_00064345 predicted 1102
7 SASI_Rn01_00064346 predicted 1339
8 SASI_Rn01_00064347 predicted 576
9 SASI_Rn01_00064348 predicted 912
10 SASI_Rn02_00259913 predicted 959
11 SASI_Rn01_00064342 predicted 1236
12 SASI_Rn01_00064344 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195797 predicted 973
2 SASI_Mm01_00195798 predicted 981
3 SASI_Mm01_00195799 predicted 808
4 SASI_Mm01_00195800 predicted 1472
5 SASI_Mm01_00195801 predicted 378
6 SASI_Mm01_00195802 predicted 1203
7 SASI_Mm02_00312707 predicted 1239
8 SASI_Mm01_00195803 predicted 854
9 SASI_Mm01_00195804 predicted 630
10 SASI_Mm01_00195805 predicted 1372
11 SASI_Mm01_00195806 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001958
VALIDATED
EEF1A2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001958.2-400s1c1
Sequence:CCGGGAAGTTCGAGACCACCAAGTACTCGAGTACTTGGTGGTCTCGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-253s1c1
Sequence:CCGGCAAATGCGGAGGTATTGACAACTCGAGTTGTCAATACCTCCGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-1477s1c1
Sequence:CCGGCATCAAGAACGTGGAGAAGAACTCGAGTTCTTCTCCACGTTCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-923s1c1
Sequence:CCGGGTGTACAAGATTGGCGGCATTCTCGAGAATGCCGCCAATCTTGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-418s1c1
Sequence:CCGGGTACTACATCACCATCATCGACTCGAGTCGATGATGGTGATGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-697s1c1
Sequence:CCGGCATCAAGAAGATCGGCTACAACTCGAGTTGTAGCCGATCTTCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-453s1c1
Sequence:CCGGGCGACTTCATCAAGAACATGACTCGAGTCATGTTCTTGATGAAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-415s1c1
Sequence:CCGGCAAGTACTACATCACCATCATCTCGAGATGATGGTGATGTAGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-278s1c1
Sequence:CCGGACCATTGAGAAGTTCGAGAAGCTCGAGCTTCTCGAACTTCTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-1184s1c1
Sequence:CCGGTTCACCTCCCAGGTCATCATCCTCGAGGATGATGACCTGGGAGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001958
VALIDATED
EEF1A2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001958.2-400s1c1
Sequence:CCGGGAAGTTCGAGACCACCAAGTACTCGAGTACTTGGTGGTCTCGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-253s1c1
Sequence:CCGGCAAATGCGGAGGTATTGACAACTCGAGTTGTCAATACCTCCGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-1477s1c1
Sequence:CCGGCATCAAGAACGTGGAGAAGAACTCGAGTTCTTCTCCACGTTCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-923s1c1
Sequence:CCGGGTGTACAAGATTGGCGGCATTCTCGAGAATGCCGCCAATCTTGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-418s1c1
Sequence:CCGGGTACTACATCACCATCATCGACTCGAGTCGATGATGGTGATGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-697s1c1
Sequence:CCGGCATCAAGAAGATCGGCTACAACTCGAGTTGTAGCCGATCTTCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-453s1c1
Sequence:CCGGGCGACTTCATCAAGAACATGACTCGAGTCATGTTCTTGATGAAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-415s1c1
Sequence:CCGGCAAGTACTACATCACCATCATCTCGAGATGATGGTGATGTAGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-278s1c1
Sequence:CCGGACCATTGAGAAGTTCGAGAAGCTCGAGCTTCTCGAACTTCTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-1184s1c1
Sequence:CCGGTTCACCTCCCAGGTCATCATCCTCGAGGATGATGACCTGGGAGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001958
VALIDATED
EEF1A2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 alpha 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001958.2-400s1c1
Sequence:CCGGGAAGTTCGAGACCACCAAGTACTCGAGTACTTGGTGGTCTCGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-253s1c1
Sequence:CCGGCAAATGCGGAGGTATTGACAACTCGAGTTGTCAATACCTCCGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-1477s1c1
Sequence:CCGGCATCAAGAACGTGGAGAAGAACTCGAGTTCTTCTCCACGTTCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-923s1c1
Sequence:CCGGGTGTACAAGATTGGCGGCATTCTCGAGAATGCCGCCAATCTTGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-418s1c1
Sequence:CCGGGTACTACATCACCATCATCGACTCGAGTCGATGATGGTGATGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-697s1c1
Sequence:CCGGCATCAAGAAGATCGGCTACAACTCGAGTTGTAGCCGATCTTCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-453s1c1
Sequence:CCGGGCGACTTCATCAAGAACATGACTCGAGTCATGTTCTTGATGAAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001958.2-415s1c1
Sequence:CCGGCAAGTACTACATCACCATCATCTCGAGATGATGGTGATGTAGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-278s1c1
Sequence:CCGGACCATTGAGAAGTTCGAGAAGCTCGAGCTTCTCGAACTTCTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001958.2-1184s1c1
Sequence:CCGGTTCACCTCCCAGGTCATCATCCTCGAGGATGATGACCTGGGAGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007906
EEF1A2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 alpha 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-1289s1c1
Sequence:CCGGGTCGGGTTCAATGTGAAGAATCTCGAGATTCTTCACATTGAACCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007906.2-1939s1c1
Sequence:CCGGCAAAGTCCAGTGGAAATTCTTCTCGAGAAGAATTTCCACTGGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-652s1c2
Sequence:CCGGCCGAGACTTCATCAAGAATATCTCGAGATATTCTTGATGAAGTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-970s1c1
Sequence:CCGGGCTGGAGCCTTCACCTAATATCTCGAGATATTAGGTGAAGGCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007906
EEF1A2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 alpha 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-1289s1c1
Sequence:CCGGGTCGGGTTCAATGTGAAGAATCTCGAGATTCTTCACATTGAACCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007906.2-1939s1c1
Sequence:CCGGCAAAGTCCAGTGGAAATTCTTCTCGAGAAGAATTTCCACTGGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-652s1c2
Sequence:CCGGCCGAGACTTCATCAAGAATATCTCGAGATATTCTTGATGAAGTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-970s1c1
Sequence:CCGGGCTGGAGCCTTCACCTAATATCTCGAGATATTAGGTGAAGGCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007906
EEF1A2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 alpha 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-1289s1c1
Sequence:CCGGGTCGGGTTCAATGTGAAGAATCTCGAGATTCTTCACATTGAACCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007906.2-1939s1c1
Sequence:CCGGCAAAGTCCAGTGGAAATTCTTCTCGAGAAGAATTTCCACTGGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-652s1c2
Sequence:CCGGCCGAGACTTCATCAAGAATATCTCGAGATATTCTTGATGAAGTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007906.2-970s1c1
Sequence:CCGGGCTGGAGCCTTCACCTAATATCTCGAGATATTAGGTGAAGGCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)