EMAIL THIS PAGE TO A FRIEND

EEF1B2

eukaryotic translation elongation factor 1 beta 2

74 Gene Product Result for
Synonyms: EEF1B EEF1B1 EF1B
UniProtKB ID: P24534, A8K795, Q6IBH9
Gene ID:
Human(1933) Summary: This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]
Mouse(55949) eukaryotic translation elongation factor 1 beta 2
Rat(363241) eukaryotic translation elongation factor 1 beta 2
domestic guinea pig(100726773) eukaryotic translation elongation factor 1 beta 2
naked mole-rat(101717085) eukaryotic translation elongation factor 1 beta 2
sheep(101115859) eukaryotic translation elongation factor 1 beta 2
Zebrafish(335370) eukaryotic translation elongation factor 1 beta 2
chicken(395723) eukaryotic translation elongation factor 1 beta 2
cow(520875) eukaryotic translation elongation factor 1 beta 2
domestic cat(101101327) eukaryotic translation elongation factor 1 beta 2
dog(478881) eukaryotic translation elongation factor 1 beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E0784 Anti-EEF1B2 (51-62) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2100651 Anti-EEF1B2 antibody produced in rabbit affinity isolated antibody guinea pig, pig, rabbit, canine, rabbit, horse, bovine, human, mouse
western blot pricing
SAB2702013 Anti-EEF1B2 antibody produced in rabbit human, mouse
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400084 Monoclonal Anti-EEF1B2 antibody produced in mouse clone 3A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001959 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037663 Rosetta Predictions human pricing
NM_001959 Rosetta Predictions human pricing
NM_021121 Rosetta Predictions human pricing
NM_001108799 Rosetta Predictions rat pricing
NM_018796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308341 predicted 517
2 SASI_Hs01_00118290 predicted 449
3 SASI_Hs01_00118292 predicted 510
4 SASI_Hs01_00118293 predicted 382
5 SASI_Hs02_00308342 predicted 573
6 SASI_Hs02_00308343 predicted 483
7 SASI_Hs01_00118296 predicted 365
8 SASI_Hs01_00118297 predicted 386
9 SASI_Hs02_00308344 predicted 369
10 SASI_Hs02_00308345 predicted 562
11 SASI_Hs01_00118288 predicted 612
12 SASI_Hs01_00118289 predicted 651
13 SASI_Hs01_00118291 predicted 559
14 SASI_Hs01_00118294 predicted 508
15 SASI_Hs01_00118295 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332893 predicted 740
2 SASI_Hs02_00332894 predicted 683
3 SASI_Hs02_00332895 predicted 732
4 SASI_Hs02_00332896 predicted 608
5 SASI_Hs02_00332897 predicted 806
6 SASI_Hs02_00332898 predicted 706
7 SASI_Hs02_00332899 predicted 601
8 SASI_Hs02_00332900 predicted 615
9 SASI_Hs02_00332901 predicted 599
10 SASI_Hs02_00332902 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354635 predicted 472
2 SASI_Hs01_00088796 predicted 404
3 SASI_Hs01_00088798 predicted 465
4 SASI_Hs01_00088799 predicted 342
5 SASI_Hs02_00354636 predicted 533
6 SASI_Hs02_00354637 predicted 433
7 SASI_Hs01_00088802 predicted 325
8 SASI_Hs01_00088803 predicted 334
9 SASI_Hs02_00354638 predicted 326
10 SASI_Hs02_00354639 predicted 516
11 SASI_Hs01_00088794 predicted 564
12 SASI_Hs01_00088795 predicted 605
13 SASI_Hs01_00088797 predicted 512
14 SASI_Hs01_00088800 predicted 465
15 SASI_Hs01_00088801 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242185 predicted 539
2 SASI_Rn02_00242186 predicted 542
3 SASI_Rn02_00242187 predicted 597
4 SASI_Rn02_00242188 predicted 709
5 SASI_Rn02_00242189 predicted 576
6 SASI_Rn02_00242190 predicted 507
7 SASI_Rn02_00242191 predicted 719
8 SASI_Rn02_00242192 predicted 545
9 SASI_Rn02_00242193 predicted 717
10 SASI_Rn02_00242194 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031974 predicted 463
2 SASI_Mm01_00031975 predicted 487
3 SASI_Mm01_00031976 predicted 233
4 SASI_Mm01_00031977 predicted 321
5 SASI_Mm01_00031978 predicted 319
6 SASI_Mm01_00031979 predicted 304
7 SASI_Mm01_00031980 predicted 337
8 SASI_Mm01_00031981 predicted 382
9 SASI_Mm01_00031982 predicted 562
10 SASI_Mm01_00031983 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018796
VALIDATED
EEF1B2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 beta 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018796.2-728s21c1
Sequence:CCGGACTACGTACAGTCCATGGATGCTCGAGCATCCATGGACTGTACGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018796.2-149s21c1
Sequence:CCGGTGGCGGACAAGAGCTACATTGCTCGAGCAATGTAGCTCTTGTCCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-300s1c1
Sequence:CCGGGCCGGGAGTGAAGAAATCTTTCTCGAGAAAGATTTCTTCACTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-505s1c1
Sequence:CCGGGCGAAGTCTTCCATCCTACTACTCGAGTAGTAGGATGGAAGACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-463s1c1
Sequence:CCGGGCACAGTATGAGTCCAAGAAACTCGAGTTTCTTGGACTCATACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-249s1c1
Sequence:CCGGCCTACGTTGGTATAATCACATCTCGAGATGTGATTATACCAACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-628s1c1
Sequence:CCGGCCAGTGGGATATGGAATTAAACTCGAGTTTAATTCCATATCCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018796
VALIDATED
EEF1B2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 beta 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018796.2-728s21c1
Sequence:CCGGACTACGTACAGTCCATGGATGCTCGAGCATCCATGGACTGTACGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018796.2-149s21c1
Sequence:CCGGTGGCGGACAAGAGCTACATTGCTCGAGCAATGTAGCTCTTGTCCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-300s1c1
Sequence:CCGGGCCGGGAGTGAAGAAATCTTTCTCGAGAAAGATTTCTTCACTCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-505s1c1
Sequence:CCGGGCGAAGTCTTCCATCCTACTACTCGAGTAGTAGGATGGAAGACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-463s1c1
Sequence:CCGGGCACAGTATGAGTCCAAGAAACTCGAGTTTCTTGGACTCATACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-249s1c1
Sequence:CCGGCCTACGTTGGTATAATCACATCTCGAGATGTGATTATACCAACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-628s1c1
Sequence:CCGGCCAGTGGGATATGGAATTAAACTCGAGTTTAATTCCATATCCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018796
VALIDATED
EEF1B2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 beta 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018796.2-728s21c1
Sequence:CCGGACTACGTACAGTCCATGGATGCTCGAGCATCCATGGACTGTACGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018796.2-149s21c1
Sequence:CCGGTGGCGGACAAGAGCTACATTGCTCGAGCAATGTAGCTCTTGTCCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-300s1c1
Sequence:CCGGGCCGGGAGTGAAGAAATCTTTCTCGAGAAAGATTTCTTCACTCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-505s1c1
Sequence:CCGGGCGAAGTCTTCCATCCTACTACTCGAGTAGTAGGATGGAAGACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-463s1c1
Sequence:CCGGGCACAGTATGAGTCCAAGAAACTCGAGTTTCTTGGACTCATACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-249s1c1
Sequence:CCGGCCTACGTTGGTATAATCACATCTCGAGATGTGATTATACCAACGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018796.2-628s1c1
Sequence:CCGGCCAGTGGGATATGGAATTAAACTCGAGTTTAATTCCATATCCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001959
VALIDATED
EEF1B2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 beta 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001959.2-527s1c1
Sequence:CCGGGATGATGACATTGACCTCTTTCTCGAGAAAGAGGTCAATGTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-570s1c1
Sequence:CCGGGTGAAGAAGCAAAGAGGCTAACTCGAGTTAGCCTCTTTGCTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-668s1c1
Sequence:CCGGGATGTGAAACCTTGGGATGATCTCGAGATCATCCCAAGGTTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-501s1c1
Sequence:CCGGGAAGTGGAGCTACAGATAGTACTCGAGTACTATCTGTAGCTCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-636s1c1
Sequence:CCGGCTGCACTTGTTGCCAAGTCTTCTCGAGAAGACTTGGCAACAAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-442s1c1
Sequence:CCGGGCCAGGAGTGAAGAAAGCTTTCTCGAGAAAGCTTTCTTCACTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-541s1c1
Sequence:CCGGCCTCTTTGGATCTGATGATGACTCGAGTCATCATCAGATCCAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-759s1c1
Sequence:CCGGCTAAACTAGTTCCAGTGGGATCTCGAGATCCCACTGGAACTAGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-554s1c1
Sequence:CCGGGATGATGAGGAGGAAAGTGAACTCGAGTTCACTTTCCTCCTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-549s1c1
Sequence:CCGGGATCTGATGATGAGGAGGAAACTCGAGTTTCCTCCTCATCATCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-647s1c1
Sequence:CCGGGCCAAGTCTTCCATCTTACTACTCGAGTAGTAAGATGGAAGACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001959
VALIDATED
EEF1B2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 beta 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001959.2-527s1c1
Sequence:CCGGGATGATGACATTGACCTCTTTCTCGAGAAAGAGGTCAATGTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-570s1c1
Sequence:CCGGGTGAAGAAGCAAAGAGGCTAACTCGAGTTAGCCTCTTTGCTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-668s1c1
Sequence:CCGGGATGTGAAACCTTGGGATGATCTCGAGATCATCCCAAGGTTTCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-501s1c1
Sequence:CCGGGAAGTGGAGCTACAGATAGTACTCGAGTACTATCTGTAGCTCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-636s1c1
Sequence:CCGGCTGCACTTGTTGCCAAGTCTTCTCGAGAAGACTTGGCAACAAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-442s1c1
Sequence:CCGGGCCAGGAGTGAAGAAAGCTTTCTCGAGAAAGCTTTCTTCACTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-541s1c1
Sequence:CCGGCCTCTTTGGATCTGATGATGACTCGAGTCATCATCAGATCCAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-759s1c1
Sequence:CCGGCTAAACTAGTTCCAGTGGGATCTCGAGATCCCACTGGAACTAGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-554s1c1
Sequence:CCGGGATGATGAGGAGGAAAGTGAACTCGAGTTCACTTTCCTCCTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-549s1c1
Sequence:CCGGGATCTGATGATGAGGAGGAAACTCGAGTTTCCTCCTCATCATCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-647s1c1
Sequence:CCGGGCCAAGTCTTCCATCTTACTACTCGAGTAGTAAGATGGAAGACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001959
VALIDATED
EEF1B2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 beta 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001959.2-527s1c1
Sequence:CCGGGATGATGACATTGACCTCTTTCTCGAGAAAGAGGTCAATGTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-570s1c1
Sequence:CCGGGTGAAGAAGCAAAGAGGCTAACTCGAGTTAGCCTCTTTGCTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-668s1c1
Sequence:CCGGGATGTGAAACCTTGGGATGATCTCGAGATCATCCCAAGGTTTCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-501s1c1
Sequence:CCGGGAAGTGGAGCTACAGATAGTACTCGAGTACTATCTGTAGCTCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-636s1c1
Sequence:CCGGCTGCACTTGTTGCCAAGTCTTCTCGAGAAGACTTGGCAACAAGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-442s1c1
Sequence:CCGGGCCAGGAGTGAAGAAAGCTTTCTCGAGAAAGCTTTCTTCACTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-541s1c1
Sequence:CCGGCCTCTTTGGATCTGATGATGACTCGAGTCATCATCAGATCCAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-759s1c1
Sequence:CCGGCTAAACTAGTTCCAGTGGGATCTCGAGATCCCACTGGAACTAGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001959.2-554s1c1
Sequence:CCGGGATGATGAGGAGGAAAGTGAACTCGAGTTCACTTTCCTCCTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-549s1c1
Sequence:CCGGGATCTGATGATGAGGAGGAAACTCGAGTTTCCTCCTCATCATCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001959.2-647s1c1
Sequence:CCGGGCCAAGTCTTCCATCTTACTACTCGAGTAGTAAGATGGAAGACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)