EMAIL THIS PAGE TO A FRIEND

EEF1D

eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)

83 Gene Product Result for
Synonyms: EF-1D EF1D FP1047
Gene ID:
Human(1936) Summary: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.[provided by RefSeq, Aug 2010]
Mouse(66656) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Rat(300033) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
sheep(101112908) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
domestic guinea pig(100732352) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
naked mole-rat(101720224) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
chicken(769368) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
cow(516473) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
domestic cat(101098687) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
dog(475115) eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001960 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001960 Rosetta Predictions human pricing
NM_032378 Rosetta Predictions human pricing
NM_001013104 Rosetta Predictions rat pricing
NM_023240 Rosetta Predictions mouse pricing
NM_029663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332903 predicted 344
2 SASI_Hs01_00119206 predicted 465
3 SASI_Hs02_00332904 predicted 666
4 SASI_Hs02_00332905 predicted 662
5 SASI_Hs02_00332906 predicted 760
6 SASI_Hs02_00332907 predicted 714
7 SASI_Hs02_00332908 predicted 714
8 SASI_Hs02_00332909 predicted 668
9 SASI_Hs02_00332910 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359766 predicted 1567
2 SASI_Hs01_00019392 predicted 1678
3 SASI_Hs02_00359767 predicted 1889
4 SASI_Hs02_00359768 predicted 1884
5 SASI_Hs02_00359769 predicted 1981
6 SASI_Hs02_00359770 predicted 1934
7 SASI_Hs02_00359771 predicted 1941
8 SASI_Hs02_00359772 predicted 1887
9 SASI_Hs01_00019393 predicted 629
10 SASI_Hs01_00019394 predicted 957
11 SASI_Hs01_00019395 predicted 1094
12 SASI_Hs01_00019396 predicted 1040
13 SASI_Hs01_00019397 predicted 573
14 SASI_Hs01_00019398 predicted 1103
15 SASI_Hs01_00019399 predicted 556
16 SASI_Hs01_00019400 predicted 1271
17 SASI_Hs01_00019401 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114449 predicted 1564
2 SASI_Rn01_00114450 predicted 1140
3 SASI_Rn01_00114451 predicted 744
4 SASI_Rn01_00114452 predicted 346
5 SASI_Rn01_00114453 predicted 746
6 SASI_Rn01_00114454 predicted 1174
7 SASI_Rn01_00114455 predicted 498
8 SASI_Rn01_00114456 predicted 847
9 SASI_Rn01_00114457 predicted 1272
10 SASI_Rn01_00114458 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071513 predicted 1173
2 SASI_Mm01_00071514 predicted 568
3 SASI_Mm01_00071515 predicted 1075
4 SASI_Mm02_00326991 predicted 1051
5 SASI_Mm02_00326992 predicted 1059
6 SASI_Mm01_00071517 predicted 720
7 SASI_Mm01_00071518 predicted 1012
8 SASI_Mm01_00071520 predicted 1064
9 SASI_Mm02_00326993 predicted 493
10 SASI_Mm02_00326994 predicted 742
11 SASI_Mm01_00071516 predicted 937
12 SASI_Mm01_00071519 predicted 896
13 SASI_Mm01_00071521 predicted 996
14 SASI_Mm01_00071522 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103602 predicted 2316
2 SASI_Mm01_00103603 predicted 1713
3 SASI_Mm01_00103604 predicted 2223
4 SASI_Mm02_00335687 predicted 2203
5 SASI_Mm02_00335688 predicted 2207
6 SASI_Mm01_00103606 predicted 1868
7 SASI_Mm01_00103607 predicted 2158
8 SASI_Mm01_00103609 predicted 2213
9 SASI_Mm02_00335689 predicted 1645
10 SASI_Mm02_00335690 predicted 1886
11 SASI_Mm01_00103605 predicted 2074
12 SASI_Mm01_00103608 predicted 2034
13 SASI_Mm01_00103610 predicted 2132
14 SASI_Mm01_00103611 predicted 2135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023240
VALIDATED
EEF1D MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023240.2-1336s1c1
Sequence:CCGGGCGAACATCTAAGTTGAGAAACTCGAGTTTCTCAACTTAGATGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-133s1c1
Sequence:CCGGGATCTGGTTTGACAAGTTTAACTCGAGTTAAACTTGTCAAACCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-925s1c1
Sequence:CCGGCATCGCAGCTTTCAACAAGATCTCGAGATCTTGTTGAAAGCTGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-398s1c1
Sequence:CCGGCAAGATTTGCAGCAGGCCATTCTCGAGAATGGCCTGCTGCAAATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023240.2-880s1c1
Sequence:CCGGCGAGGAGGAGATCACCAAATTCTCGAGAATTTGGTGATCTCCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-925s21c1
Sequence:CCGGCATCGCAGCTTTCAACAAGATCTCGAGATCTTGTTGAAAGCTGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023240.2-133s21c1
Sequence:CCGGGATCTGGTTTGACAAGTTTAACTCGAGTTAAACTTGTCAAACCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-880s21c1
Sequence:CCGGCGAGGAGGAGATCACCAAATTCTCGAGAATTTGGTGATCTCCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-398s21c1
Sequence:CCGGCAAGATTTGCAGCAGGCCATTCTCGAGAATGGCCTGCTGCAAATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023240
VALIDATED
EEF1D MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023240.2-1336s1c1
Sequence:CCGGGCGAACATCTAAGTTGAGAAACTCGAGTTTCTCAACTTAGATGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-133s1c1
Sequence:CCGGGATCTGGTTTGACAAGTTTAACTCGAGTTAAACTTGTCAAACCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-925s1c1
Sequence:CCGGCATCGCAGCTTTCAACAAGATCTCGAGATCTTGTTGAAAGCTGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-398s1c1
Sequence:CCGGCAAGATTTGCAGCAGGCCATTCTCGAGAATGGCCTGCTGCAAATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023240.2-880s1c1
Sequence:CCGGCGAGGAGGAGATCACCAAATTCTCGAGAATTTGGTGATCTCCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-925s21c1
Sequence:CCGGCATCGCAGCTTTCAACAAGATCTCGAGATCTTGTTGAAAGCTGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023240.2-133s21c1
Sequence:CCGGGATCTGGTTTGACAAGTTTAACTCGAGTTAAACTTGTCAAACCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-880s21c1
Sequence:CCGGCGAGGAGGAGATCACCAAATTCTCGAGAATTTGGTGATCTCCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-398s21c1
Sequence:CCGGCAAGATTTGCAGCAGGCCATTCTCGAGAATGGCCTGCTGCAAATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023240
VALIDATED
EEF1D MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023240.2-1336s1c1
Sequence:CCGGGCGAACATCTAAGTTGAGAAACTCGAGTTTCTCAACTTAGATGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-133s1c1
Sequence:CCGGGATCTGGTTTGACAAGTTTAACTCGAGTTAAACTTGTCAAACCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-925s1c1
Sequence:CCGGCATCGCAGCTTTCAACAAGATCTCGAGATCTTGTTGAAAGCTGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023240.2-398s1c1
Sequence:CCGGCAAGATTTGCAGCAGGCCATTCTCGAGAATGGCCTGCTGCAAATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023240.2-880s1c1
Sequence:CCGGCGAGGAGGAGATCACCAAATTCTCGAGAATTTGGTGATCTCCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-925s21c1
Sequence:CCGGCATCGCAGCTTTCAACAAGATCTCGAGATCTTGTTGAAAGCTGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023240.2-133s21c1
Sequence:CCGGGATCTGGTTTGACAAGTTTAACTCGAGTTAAACTTGTCAAACCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-880s21c1
Sequence:CCGGCGAGGAGGAGATCACCAAATTCTCGAGAATTTGGTGATCTCCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023240.2-398s21c1
Sequence:CCGGCAAGATTTGCAGCAGGCCATTCTCGAGAATGGCCTGCTGCAAATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001960
VALIDATED
EEF1D MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001960.2-230s1c1
Sequence:CCGGGCCAGAGAGAACATCCAGAAACTCGAGTTTCTGGATGTTCTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-794s1c1
Sequence:CCGGCGGAAGCTACAGATTCAGTGTCTCGAGACACTGAATCTGTAGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-628s1c1
Sequence:CCGGGAAGGCCAAGAAGCCTGCACTCTCGAGAGTGCAGGCTTCTTGGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-531s1c1
Sequence:CCGGAGGATGATGACATTGACCTGTCTCGAGACAGGTCAATGTCATCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001960.2-130s1c1
Sequence:CCGGCGACGCAGAAAGGAGATTCTACTCGAGTAGAATCTCCTTTCTGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-405s21c1
Sequence:CCGGAGATTCTACGAGCAGATGAACCTCGAGGTTCATCTGCTCGTAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-381s21c1
Sequence:CCGGTTCAAATATGACGACGCAGAACTCGAGTTCTGCGTCGTCATATTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-465s21c1
Sequence:CCGGAGCGTGATCCTCCGTGACATTCTCGAGAATGTCACGGAGGATCACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-481s21c1
Sequence:CCGGACATTGCGAGAGCCAGAGAGACTCGAGTCTCTCTGGCTCTCGCAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-871s21c1
Sequence:CCGGTACGGCAGTACGCGGAGAAGACTCGAGTCTTCTCCGCGTACTGCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-728s21c1
Sequence:CCGGCGTATCTCCCATGCGCCAAGTCTCGAGACTTGGCGCATGGGAGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-809s21c1
Sequence:CCGGCCTGTTTGGCAGTGACAATGACTCGAGTCATTGTCACTGCCAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-580s21c1
Sequence:CCGGTCCGGATTGCCAGTCTGGAAGCTCGAGCTTCCAGACTGGCAATCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-367s21c1
Sequence:CCGGTCTGGTTCGACAAGTTCAAATCTCGAGATTTGAACTTGTCGAACCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001960
VALIDATED
EEF1D MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001960.2-230s1c1
Sequence:CCGGGCCAGAGAGAACATCCAGAAACTCGAGTTTCTGGATGTTCTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-794s1c1
Sequence:CCGGCGGAAGCTACAGATTCAGTGTCTCGAGACACTGAATCTGTAGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-628s1c1
Sequence:CCGGGAAGGCCAAGAAGCCTGCACTCTCGAGAGTGCAGGCTTCTTGGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-531s1c1
Sequence:CCGGAGGATGATGACATTGACCTGTCTCGAGACAGGTCAATGTCATCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001960.2-130s1c1
Sequence:CCGGCGACGCAGAAAGGAGATTCTACTCGAGTAGAATCTCCTTTCTGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-405s21c1
Sequence:CCGGAGATTCTACGAGCAGATGAACCTCGAGGTTCATCTGCTCGTAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-381s21c1
Sequence:CCGGTTCAAATATGACGACGCAGAACTCGAGTTCTGCGTCGTCATATTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-465s21c1
Sequence:CCGGAGCGTGATCCTCCGTGACATTCTCGAGAATGTCACGGAGGATCACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-481s21c1
Sequence:CCGGACATTGCGAGAGCCAGAGAGACTCGAGTCTCTCTGGCTCTCGCAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-871s21c1
Sequence:CCGGTACGGCAGTACGCGGAGAAGACTCGAGTCTTCTCCGCGTACTGCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-728s21c1
Sequence:CCGGCGTATCTCCCATGCGCCAAGTCTCGAGACTTGGCGCATGGGAGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-809s21c1
Sequence:CCGGCCTGTTTGGCAGTGACAATGACTCGAGTCATTGTCACTGCCAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-580s21c1
Sequence:CCGGTCCGGATTGCCAGTCTGGAAGCTCGAGCTTCCAGACTGGCAATCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-367s21c1
Sequence:CCGGTCTGGTTCGACAAGTTCAAATCTCGAGATTTGAACTTGTCGAACCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001960
VALIDATED
EEF1D MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001960.2-230s1c1
Sequence:CCGGGCCAGAGAGAACATCCAGAAACTCGAGTTTCTGGATGTTCTCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-794s1c1
Sequence:CCGGCGGAAGCTACAGATTCAGTGTCTCGAGACACTGAATCTGTAGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-628s1c1
Sequence:CCGGGAAGGCCAAGAAGCCTGCACTCTCGAGAGTGCAGGCTTCTTGGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001960.2-531s1c1
Sequence:CCGGAGGATGATGACATTGACCTGTCTCGAGACAGGTCAATGTCATCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001960.2-130s1c1
Sequence:CCGGCGACGCAGAAAGGAGATTCTACTCGAGTAGAATCTCCTTTCTGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-405s21c1
Sequence:CCGGAGATTCTACGAGCAGATGAACCTCGAGGTTCATCTGCTCGTAGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-381s21c1
Sequence:CCGGTTCAAATATGACGACGCAGAACTCGAGTTCTGCGTCGTCATATTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-465s21c1
Sequence:CCGGAGCGTGATCCTCCGTGACATTCTCGAGAATGTCACGGAGGATCACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-481s21c1
Sequence:CCGGACATTGCGAGAGCCAGAGAGACTCGAGTCTCTCTGGCTCTCGCAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-871s21c1
Sequence:CCGGTACGGCAGTACGCGGAGAAGACTCGAGTCTTCTCCGCGTACTGCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-728s21c1
Sequence:CCGGCGTATCTCCCATGCGCCAAGTCTCGAGACTTGGCGCATGGGAGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-809s21c1
Sequence:CCGGCCTGTTTGGCAGTGACAATGACTCGAGTCATTGTCACTGCCAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-580s21c1
Sequence:CCGGTCCGGATTGCCAGTCTGGAAGCTCGAGCTTCCAGACTGGCAATCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001960.3-367s21c1
Sequence:CCGGTCTGGTTCGACAAGTTCAAATCTCGAGATTTGAACTTGTCGAACCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)