EMAIL THIS PAGE TO A FRIEND

EEF1DP3

eukaryotic translation elongation factor 1 delta pseudogene 3

12 Gene Product Result for
Species: Human EEF1DP3(196549)
UniProtKB ID: Q658K8, Q08AR3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145293 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059606 predicted 2883
2 SASI_Hs01_00059607 predicted 2556
3 SASI_Hs01_00059608 predicted 2866
4 SASI_Hs01_00059609 predicted 2885
5 SASI_Hs01_00059610 predicted 2876
6 SASI_Hs01_00059611 predicted 3024
7 SASI_Hs01_00059612 predicted 2603
8 SASI_Hs01_00059613 predicted 2596
9 SASI_Hs01_00059614 predicted 2447
10 SASI_Hs01_00059615 predicted 3245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145293
EEF1DP3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 delta pseudogene 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-558s1c1
Sequence:CCGGCATGATATTGCCAGAGCCAGACTCGAGTCTGGCTCTGGCAATATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-545s1c1
Sequence:CCGGCAGCATGATCCTCCATGATATCTCGAGATATCATGGAGGATCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-452s1c1
Sequence:CCGGGATCTGGTTCCACAAGTTCAACTCGAGTTGAACTTGTGGAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-461s1c1
Sequence:CCGGCCACAAGTTCAAATATGGCGACTCGAGTCGCCATATTTGAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-455s1c1
Sequence:CCGGCTGGTTCCACAAGTTCAAATACTCGAGTATTTGAACTTGTGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145293.2-2843s1c1
Sequence:CCGGGACGATGACATTGACCTGTTTCTCGAGAAACAGGTCAATGTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-449s1c1
Sequence:CCGGGAAGATCTGGTTCCACAAGTTCTCGAGAACTTGTGGAACCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-467s1c1
Sequence:CCGGGTTCAAATATGGCGATGCAGACTCGAGTCTGCATCGCCATATTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-483s1c1
Sequence:CCGGGCAGAAAGGAGATTCTACGAACTCGAGTTCGTAGAATCTCCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145293
EEF1DP3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 delta pseudogene 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-558s1c1
Sequence:CCGGCATGATATTGCCAGAGCCAGACTCGAGTCTGGCTCTGGCAATATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-545s1c1
Sequence:CCGGCAGCATGATCCTCCATGATATCTCGAGATATCATGGAGGATCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-452s1c1
Sequence:CCGGGATCTGGTTCCACAAGTTCAACTCGAGTTGAACTTGTGGAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-461s1c1
Sequence:CCGGCCACAAGTTCAAATATGGCGACTCGAGTCGCCATATTTGAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-455s1c1
Sequence:CCGGCTGGTTCCACAAGTTCAAATACTCGAGTATTTGAACTTGTGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145293.2-2843s1c1
Sequence:CCGGGACGATGACATTGACCTGTTTCTCGAGAAACAGGTCAATGTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-449s1c1
Sequence:CCGGGAAGATCTGGTTCCACAAGTTCTCGAGAACTTGTGGAACCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-467s1c1
Sequence:CCGGGTTCAAATATGGCGATGCAGACTCGAGTCTGCATCGCCATATTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-483s1c1
Sequence:CCGGGCAGAAAGGAGATTCTACGAACTCGAGTTCGTAGAATCTCCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145293
EEF1DP3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 delta pseudogene 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-558s1c1
Sequence:CCGGCATGATATTGCCAGAGCCAGACTCGAGTCTGGCTCTGGCAATATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-545s1c1
Sequence:CCGGCAGCATGATCCTCCATGATATCTCGAGATATCATGGAGGATCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-452s1c1
Sequence:CCGGGATCTGGTTCCACAAGTTCAACTCGAGTTGAACTTGTGGAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-461s1c1
Sequence:CCGGCCACAAGTTCAAATATGGCGACTCGAGTCGCCATATTTGAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-455s1c1
Sequence:CCGGCTGGTTCCACAAGTTCAAATACTCGAGTATTTGAACTTGTGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145293.2-2843s1c1
Sequence:CCGGGACGATGACATTGACCTGTTTCTCGAGAAACAGGTCAATGTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-449s1c1
Sequence:CCGGGAAGATCTGGTTCCACAAGTTCTCGAGAACTTGTGGAACCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145293.1-467s1c1
Sequence:CCGGGTTCAAATATGGCGATGCAGACTCGAGTCTGCATCGCCATATTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145293.1-483s1c1
Sequence:CCGGGCAGAAAGGAGATTCTACGAACTCGAGTTCGTAGAATCTCCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks