EMAIL THIS PAGE TO A FRIEND

EEF1E1

eukaryotic translation elongation factor 1 epsilon 1

63 Gene Product Result for
Synonyms: AIMP3 P18
UniProtKB ID: O43324, C9JLK5, Q5THS2
Gene ID:
Human(9521) Summary: This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010]
Mouse(66143) eukaryotic translation elongation factor 1 epsilon 1
Rat(291057) eukaryotic translation elongation factor 1 epsilon 1
chicken(420865) eukaryotic translation elongation factor 1 epsilon 1
dog(478717) eukaryotic translation elongation factor 1 epsilon 1
domestic cat(101097893) eukaryotic translation elongation factor 1 epsilon 1
cow(617105) eukaryotic translation elongation factor 1 epsilon 1
naked mole-rat(101706473) eukaryotic translation elongation factor 1 epsilon 1
domestic guinea pig(100734626) eukaryotic translation elongation factor 1 epsilon 1
sheep(100135689) eukaryotic translation elongation factor 1 epsilon 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004280 Rosetta Predictions human pricing
NM_001106106 Rosetta Predictions rat pricing
NM_025380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189548 predicted 303
2 SASI_Hs02_00337265 predicted 396
3 SASI_Hs01_00189549 predicted 308
4 SASI_Hs01_00189550 predicted 761
5 SASI_Hs01_00189551 predicted 344
6 SASI_Hs01_00189552 predicted 564
7 SASI_Hs01_00189553 predicted 487
8 SASI_Hs01_00189554 predicted 224
9 SASI_Hs01_00189555 predicted 441
10 SASI_Hs01_00189556 predicted 520
11 SASI_Hs01_00189557 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215682 predicted 605
2 SASI_Rn02_00215683 predicted 331
3 SASI_Rn02_00215684 predicted 663
4 SASI_Rn02_00215685 predicted 589
5 SASI_Rn02_00215686 predicted 703
6 SASI_Rn02_00215687 predicted 615
7 SASI_Rn02_00215688 predicted 708
8 SASI_Rn02_00215689 predicted 713
9 SASI_Rn02_00215690 predicted 660
10 SASI_Rn02_00215691 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032973 predicted 604
2 SASI_Mm01_00032974 predicted 534
3 SASI_Mm01_00032975 predicted 315
4 SASI_Mm01_00032976 predicted 487
5 SASI_Mm01_00032977 predicted 308
6 SASI_Mm01_00032978 predicted 404
7 SASI_Mm01_00032979 predicted 494
8 SASI_Mm01_00032980 predicted 614
9 SASI_Mm01_00032981 predicted 446
10 SASI_Mm01_00032982 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004280
VALIDATED
EEF1E1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 epsilon 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004280.2-615s1c1
Sequence:CCGGCCACAGGACTAATGTAAATTACTCGAGTAATTTACATTAGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004280.2-169s1c1
Sequence:CCGGGCAGCTCATCTAGTCAAGCAACTCGAGTTGCTTGACTAGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004280.2-232s1c1
Sequence:CCGGGCAATCGTTCAGCAGTGGTTACTCGAGTAACCACTGCTGAACGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004280.2-146s1c1
Sequence:CCGGGTCTAACAGGATTGACTACTACTCGAGTAGTAGTCAATCCTGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004280.2-488s1c1
Sequence:CCGGGCATCAGGCAACATCTGTCTACTCGAGTAGACAGATGTTGCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004280.4-565s21c1
Sequence:CCGGTCATCAAGAACAGACTATATACTCGAGTATATAGTCTGTTCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-193s21c1
Sequence:CCGGGTCTAACAGGATTGACTACTACTCGAGTAGTAGTCAATCCTGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-438s21c1
Sequence:CCGGTATGGACTTCATCGCTTTATACTCGAGTATAAAGCGATGAAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004280.4-611s21c1
Sequence:CCGGGCCATACAGAAGATCTATTAACTCGAGTTAATAGATCTTCTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-390s21c1
Sequence:CCGGGTCTACCTTACAGGGTATAACCTCGAGGTTATACCCTGTAAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004280
VALIDATED
EEF1E1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 epsilon 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004280.2-615s1c1
Sequence:CCGGCCACAGGACTAATGTAAATTACTCGAGTAATTTACATTAGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004280.2-169s1c1
Sequence:CCGGGCAGCTCATCTAGTCAAGCAACTCGAGTTGCTTGACTAGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004280.2-232s1c1
Sequence:CCGGGCAATCGTTCAGCAGTGGTTACTCGAGTAACCACTGCTGAACGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004280.2-146s1c1
Sequence:CCGGGTCTAACAGGATTGACTACTACTCGAGTAGTAGTCAATCCTGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004280.2-488s1c1
Sequence:CCGGGCATCAGGCAACATCTGTCTACTCGAGTAGACAGATGTTGCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004280.4-565s21c1
Sequence:CCGGTCATCAAGAACAGACTATATACTCGAGTATATAGTCTGTTCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-193s21c1
Sequence:CCGGGTCTAACAGGATTGACTACTACTCGAGTAGTAGTCAATCCTGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-438s21c1
Sequence:CCGGTATGGACTTCATCGCTTTATACTCGAGTATAAAGCGATGAAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004280.4-611s21c1
Sequence:CCGGGCCATACAGAAGATCTATTAACTCGAGTTAATAGATCTTCTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-390s21c1
Sequence:CCGGGTCTACCTTACAGGGTATAACCTCGAGGTTATACCCTGTAAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004280
VALIDATED
EEF1E1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 epsilon 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004280.2-615s1c1
Sequence:CCGGCCACAGGACTAATGTAAATTACTCGAGTAATTTACATTAGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004280.2-169s1c1
Sequence:CCGGGCAGCTCATCTAGTCAAGCAACTCGAGTTGCTTGACTAGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004280.2-232s1c1
Sequence:CCGGGCAATCGTTCAGCAGTGGTTACTCGAGTAACCACTGCTGAACGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004280.2-146s1c1
Sequence:CCGGGTCTAACAGGATTGACTACTACTCGAGTAGTAGTCAATCCTGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004280.2-488s1c1
Sequence:CCGGGCATCAGGCAACATCTGTCTACTCGAGTAGACAGATGTTGCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004280.4-565s21c1
Sequence:CCGGTCATCAAGAACAGACTATATACTCGAGTATATAGTCTGTTCTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-193s21c1
Sequence:CCGGGTCTAACAGGATTGACTACTACTCGAGTAGTAGTCAATCCTGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-438s21c1
Sequence:CCGGTATGGACTTCATCGCTTTATACTCGAGTATAAAGCGATGAAGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004280.4-611s21c1
Sequence:CCGGGCCATACAGAAGATCTATTAACTCGAGTTAATAGATCTTCTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004280.4-390s21c1
Sequence:CCGGGTCTACCTTACAGGGTATAACCTCGAGGTTATACCCTGTAAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025380
VALIDATED
EEF1E1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 epsilon 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-691s1c1
Sequence:CCGGCCTGTAGTTGAGGCTTCGTAACTCGAGTTACGAAGCCTCAACTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025380.1-322s1c1
Sequence:CCGGCTTGAAGATAAAGTCTACCTTCTCGAGAAGGTAGACTTTATCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-134s1c1
Sequence:CCGGCGAGTCTAATGGGATTGAGTACTCGAGTACTCAATCCCATTAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025380.1-301s1c1
Sequence:CCGGCTGAAGGATCTTAATTCCTATCTCGAGATAGGAATTAAGATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-394s1c1
Sequence:CCGGCGCTTTATAGTTGACCTGACACTCGAGTGTCAGGTCAACTATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-318s21c1
Sequence:CCGGCTGAAGGATCTTAATTCCTATCTCGAGATAGGAATTAAGATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025380.2-708s21c1
Sequence:CCGGCCTGTAGTTGAGGCTTCGTAACTCGAGTTACGAAGCCTCAACTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-411s21c1
Sequence:CCGGCGCTTTATAGTTGACCTGACACTCGAGTGTCAGGTCAACTATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-339s21c1
Sequence:CCGGCTTGAAGATAAAGTCTACCTTCTCGAGAAGGTAGACTTTATCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025380
VALIDATED
EEF1E1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 epsilon 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-691s1c1
Sequence:CCGGCCTGTAGTTGAGGCTTCGTAACTCGAGTTACGAAGCCTCAACTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025380.1-322s1c1
Sequence:CCGGCTTGAAGATAAAGTCTACCTTCTCGAGAAGGTAGACTTTATCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-134s1c1
Sequence:CCGGCGAGTCTAATGGGATTGAGTACTCGAGTACTCAATCCCATTAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025380.1-301s1c1
Sequence:CCGGCTGAAGGATCTTAATTCCTATCTCGAGATAGGAATTAAGATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-394s1c1
Sequence:CCGGCGCTTTATAGTTGACCTGACACTCGAGTGTCAGGTCAACTATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-318s21c1
Sequence:CCGGCTGAAGGATCTTAATTCCTATCTCGAGATAGGAATTAAGATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025380.2-708s21c1
Sequence:CCGGCCTGTAGTTGAGGCTTCGTAACTCGAGTTACGAAGCCTCAACTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-411s21c1
Sequence:CCGGCGCTTTATAGTTGACCTGACACTCGAGTGTCAGGTCAACTATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-339s21c1
Sequence:CCGGCTTGAAGATAAAGTCTACCTTCTCGAGAAGGTAGACTTTATCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025380
VALIDATED
EEF1E1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 epsilon 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-691s1c1
Sequence:CCGGCCTGTAGTTGAGGCTTCGTAACTCGAGTTACGAAGCCTCAACTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025380.1-322s1c1
Sequence:CCGGCTTGAAGATAAAGTCTACCTTCTCGAGAAGGTAGACTTTATCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-134s1c1
Sequence:CCGGCGAGTCTAATGGGATTGAGTACTCGAGTACTCAATCCCATTAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025380.1-301s1c1
Sequence:CCGGCTGAAGGATCTTAATTCCTATCTCGAGATAGGAATTAAGATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025380.1-394s1c1
Sequence:CCGGCGCTTTATAGTTGACCTGACACTCGAGTGTCAGGTCAACTATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-318s21c1
Sequence:CCGGCTGAAGGATCTTAATTCCTATCTCGAGATAGGAATTAAGATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025380.2-708s21c1
Sequence:CCGGCCTGTAGTTGAGGCTTCGTAACTCGAGTTACGAAGCCTCAACTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-411s21c1
Sequence:CCGGCGCTTTATAGTTGACCTGACACTCGAGTGTCAGGTCAACTATAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025380.2-339s21c1
Sequence:CCGGCTTGAAGATAAAGTCTACCTTCTCGAGAAGGTAGACTTTATCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks