EMAIL THIS PAGE TO A FRIEND

EEF1G

eukaryotic translation elongation factor 1 gamma

56 Gene Product Result for
Synonyms: EF1G GIG35
UniProtKB ID: P26641, Q6PJ62, Q6PK31, Q96CU2, Q9P196
Gene ID:
Human(1937) Summary: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Mouse(67160) eukaryotic translation elongation factor 1 gamma
Rat(293725) eukaryotic translation elongation factor 1 gamma
Zebrafish(195822) eukaryotic translation elongation factor 1 gamma
chicken(100526660) eukaryotic translation elongation factor 1 gamma
dog(611396) eukaryotic translation elongation factor 1 gamma
Horse(100009686) eukaryotic translation elongation factor 1 gamma
cow(326581) eukaryotic translation elongation factor 1 gamma
domestic cat(101088027) eukaryotic translation elongation factor 1 gamma
sheep(101111240) eukaryotic translation elongation factor 1 gamma
Domestic Rabbit(100009282) eukaryotic translation elongation factor 1 gamma
domestic guinea pig(100733216) eukaryotic translation elongation factor 1 gamma
naked mole-rat(101716516) eukaryotic translation elongation factor 1 gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001404 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007111 MISSION® esiRNA esiRNA targeting mouse Eef1g (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001404 Rosetta Predictions human pricing
NM_001004223 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152983 predicted 495
2 SASI_Hs01_00152984 predicted 494
3 SASI_Hs02_00331781 predicted 749
4 SASI_Hs01_00152987 predicted 1023
5 SASI_Hs02_00331782 predicted 759
6 SASI_Hs01_00152988 predicted 438
7 SASI_Hs02_00331783 predicted 564
8 SASI_Hs02_00331784 predicted 1014
9 SASI_Hs02_00331785 predicted 364
10 SASI_Hs02_00331786 predicted 282
11 SASI_Hs01_00152985 predicted 618
12 SASI_Hs01_00152986 predicted 620
13 SASI_Hs01_00152989 predicted 1159
14 SASI_Hs01_00152990 predicted 657
15 SASI_Hs01_00152991 predicted 1001
16 SASI_Hs01_00152992 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198217 predicted 484
2 SASI_Rn02_00198218 predicted 274
3 SASI_Rn02_00198219 predicted 198
4 SASI_Rn02_00198220 predicted 354
5 SASI_Rn02_00198221 predicted 1000
6 SASI_Rn02_00198222 predicted 371
7 SASI_Rn02_00198223 predicted 1165
8 SASI_Rn02_00198224 predicted 225
9 SASI_Rn02_00198225 predicted 391
10 SASI_Rn02_00198226 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026007
VALIDATED
EEF1G MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 gamma
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-387s21c1
Sequence:CCGGAGCAATGCCATTGCCTATTATCTCGAGATAATAGGCAATGGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.4-640s1c1
Sequence:CCGGGAGTGACACTGGCTGATATTACTCGAGTAATATCAGCCAGTGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-672s21c1
Sequence:CCGGACCCTGTTGTGGCTCTATAAACTCGAGTTTATAGAGCCACAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-640s21c1
Sequence:CCGGGAGTGACACTGGCTGATATTACTCGAGTAATATCAGCCAGTGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-740s21c1
Sequence:CCGGGTGGTTCCTTACCTGCATTAACTCGAGTTAATGCAGGTAAGGAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-1346s21c1
Sequence:CCGGGGTGGACTATGAGTCGTATACCTCGAGGTATACGACTCATAGTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.2-1119s1c1
Sequence:CCGGGCAGCTCCATTTCTGGTGTTTCTCGAGAAACACCAGAAATGGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.2-227s1c1
Sequence:CCGGGAGAGCAATGCCATTGCCTATCTCGAGATAGGCAATGGCATTGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026007
VALIDATED
EEF1G MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 gamma
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-387s21c1
Sequence:CCGGAGCAATGCCATTGCCTATTATCTCGAGATAATAGGCAATGGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.4-640s1c1
Sequence:CCGGGAGTGACACTGGCTGATATTACTCGAGTAATATCAGCCAGTGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-672s21c1
Sequence:CCGGACCCTGTTGTGGCTCTATAAACTCGAGTTTATAGAGCCACAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-640s21c1
Sequence:CCGGGAGTGACACTGGCTGATATTACTCGAGTAATATCAGCCAGTGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-740s21c1
Sequence:CCGGGTGGTTCCTTACCTGCATTAACTCGAGTTAATGCAGGTAAGGAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-1346s21c1
Sequence:CCGGGGTGGACTATGAGTCGTATACCTCGAGGTATACGACTCATAGTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.2-1119s1c1
Sequence:CCGGGCAGCTCCATTTCTGGTGTTTCTCGAGAAACACCAGAAATGGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.2-227s1c1
Sequence:CCGGGAGAGCAATGCCATTGCCTATCTCGAGATAGGCAATGGCATTGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026007
VALIDATED
EEF1G MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 gamma
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-387s21c1
Sequence:CCGGAGCAATGCCATTGCCTATTATCTCGAGATAATAGGCAATGGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.4-640s1c1
Sequence:CCGGGAGTGACACTGGCTGATATTACTCGAGTAATATCAGCCAGTGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-672s21c1
Sequence:CCGGACCCTGTTGTGGCTCTATAAACTCGAGTTTATAGAGCCACAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-640s21c1
Sequence:CCGGGAGTGACACTGGCTGATATTACTCGAGTAATATCAGCCAGTGTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-740s21c1
Sequence:CCGGGTGGTTCCTTACCTGCATTAACTCGAGTTAATGCAGGTAAGGAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026007.4-1346s21c1
Sequence:CCGGGGTGGACTATGAGTCGTATACCTCGAGGTATACGACTCATAGTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.2-1119s1c1
Sequence:CCGGGCAGCTCCATTTCTGGTGTTTCTCGAGAAACACCAGAAATGGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026007.2-227s1c1
Sequence:CCGGGAGAGCAATGCCATTGCCTATCTCGAGATAGGCAATGGCATTGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001404
VALIDATED
EEF1G MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 1 gamma
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-1317s21c1
Sequence:CCGGCAGGTGGACTACGAGTCATACCTCGAGGTATGACTCGTAGTCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-645s21c1
Sequence:CCGGACCCTGTTGTGGCTCTATAAGCTCGAGCTTATAGAGCCACAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-444s21c1
Sequence:CCGGAGCTTTGCTGATTCCGATATACTCGAGTATATCGGAATCAGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-1056s21c1
Sequence:CCGGTCTGTGGCACTGCCATATTTCCTCGAGGAAATATGGCAGTGCCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001404.3-904s1c1
Sequence:CCGGGTTGGATGAATTTAAGCGCAACTCGAGTTGCGCTTAAATTCATCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001404
VALIDATED
EEF1G MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 1 gamma
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-1317s21c1
Sequence:CCGGCAGGTGGACTACGAGTCATACCTCGAGGTATGACTCGTAGTCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-645s21c1
Sequence:CCGGACCCTGTTGTGGCTCTATAAGCTCGAGCTTATAGAGCCACAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-444s21c1
Sequence:CCGGAGCTTTGCTGATTCCGATATACTCGAGTATATCGGAATCAGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-1056s21c1
Sequence:CCGGTCTGTGGCACTGCCATATTTCCTCGAGGAAATATGGCAGTGCCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001404.3-904s1c1
Sequence:CCGGGTTGGATGAATTTAAGCGCAACTCGAGTTGCGCTTAAATTCATCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001404
VALIDATED
EEF1G MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 1 gamma
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-1317s21c1
Sequence:CCGGCAGGTGGACTACGAGTCATACCTCGAGGTATGACTCGTAGTCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-645s21c1
Sequence:CCGGACCCTGTTGTGGCTCTATAAGCTCGAGCTTATAGAGCCACAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-444s21c1
Sequence:CCGGAGCTTTGCTGATTCCGATATACTCGAGTATATCGGAATCAGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001404.4-1056s21c1
Sequence:CCGGTCTGTGGCACTGCCATATTTCCTCGAGGAAATATGGCAGTGCCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001404.3-904s1c1
Sequence:CCGGGTTGGATGAATTTAAGCGCAACTCGAGTTGCGCTTAAATTCATCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)