EMAIL THIS PAGE TO A FRIEND

EEF2

eukaryotic translation elongation factor 2

66 Gene Product Result for
Synonyms: EEF-2 EF-2 EF2
UniProtKB ID: P13639, B2RMP5, D6W618, Q58J86
Gene ID:
Human(1938) Summary: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
Mouse(13629) eukaryotic translation elongation factor 2
Rat(29565) eukaryotic translation elongation factor 2
Zebrafish(30373) eukaryotic translation elongation factor 2
cow(281138) eukaryotic translation elongation factor 2
domestic cat(101089583) eukaryotic translation elongation factor 2
dog(476744) eukaryotic translation elongation factor 2
chicken(396325) eukaryotic translation elongation factor 2
naked mole-rat(101710545) eukaryotic translation elongation factor 2
domestic guinea pig(100729951) eukaryotic translation elongation factor 2
sheep(101114105) eukaryotic translation elongation factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001961 Rosetta Predictions human pricing
NM_017245 Rosetta Predictions rat pricing
NM_007907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212211 predicted 976
2 SASI_Hs01_00212214 predicted 251
3 SASI_Hs01_00212216 predicted 1309
4 SASI_Hs01_00212217 predicted 525
5 SASI_Hs01_00212218 predicted 2432
6 SASI_Hs01_00212219 predicted 2303
7 SASI_Hs01_00212220 predicted 826
8 SASI_Hs02_00332911 predicted 1251
9 SASI_Hs02_00332912 predicted 687
10 SASI_Hs02_00332913 predicted 990
11 SASI_Hs01_00212212 predicted 1565
12 SASI_Hs01_00212213 predicted 2723
13 SASI_Hs01_00212215 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073866 predicted 1536
2 SASI_Rn01_00073867 predicted 2113
3 SASI_Rn01_00073868 predicted 1324
4 SASI_Rn01_00073869 predicted 1160
5 SASI_Rn01_00073870 predicted 2160
6 SASI_Rn01_00073872 predicted 885
7 SASI_Rn02_00261622 predicted 2153
8 SASI_Rn02_00261623 predicted 885
9 SASI_Rn01_00073873 predicted 879
10 SASI_Rn01_00073874 predicted 1289
11 SASI_Rn01_00073871 predicted 1272
12 SASI_Rn01_00073875 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312708 predicted 907
2 SASI_Mm01_00135473 predicted 1254
3 SASI_Mm02_00312709 predicted 904
4 SASI_Mm02_00312710 predicted 1180
5 SASI_Mm01_00135478 predicted 1252
6 SASI_Mm02_00312711 predicted 1133
7 SASI_Mm01_00135479 predicted 902
8 SASI_Mm02_00312712 predicted 987
9 SASI_Mm02_00312713 predicted 521
10 SASI_Mm02_00312714 predicted 398
11 SASI_Mm01_00135474 predicted 1557
12 SASI_Mm01_00135475 predicted 1397
13 SASI_Mm01_00135476 predicted 1551
14 SASI_Mm01_00135477 predicted 1395
15 SASI_Mm01_00135480 predicted 827
16 SASI_Mm01_00135481 predicted 1801
17 SASI_Mm01_00135482 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007907
VALIDATED
EEF2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-893s1c1
Sequence:CCGGCAAGTTCAGTAAGTCAGCCAACTCGAGTTGGCTGACTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1310s1c1
Sequence:CCGGCTATGCCTTTGGTAGAGTGTTCTCGAGAACACTCTACCAAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-108s1c1
Sequence:CCGGCGTGCCATCATGGACAAGAAACTCGAGTTTCTTGTCCATGATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1255s1c1
Sequence:CCGGGCCCACTTATGATGTACATTTCTCGAGAAATGTACATCATAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1133s1c1
Sequence:CCGGGCAGATGATCACCATCCACTTCTCGAGAAGTGGATGGTGATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-893s21c1
Sequence:CCGGCAAGTTCAGTAAGTCAGCCAACTCGAGTTGGCTGACTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-108s21c1
Sequence:CCGGCGTGCCATCATGGACAAGAAACTCGAGTTTCTTGTCCATGATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007907.1-1310s21c1
Sequence:CCGGCTATGCCTTTGGTAGAGTGTTCTCGAGAACACTCTACCAAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-1255s21c1
Sequence:CCGGGCCCACTTATGATGTACATTTCTCGAGAAATGTACATCATAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-1133s21c1
Sequence:CCGGGCAGATGATCACCATCCACTTCTCGAGAAGTGGATGGTGATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007907
VALIDATED
EEF2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-893s1c1
Sequence:CCGGCAAGTTCAGTAAGTCAGCCAACTCGAGTTGGCTGACTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1310s1c1
Sequence:CCGGCTATGCCTTTGGTAGAGTGTTCTCGAGAACACTCTACCAAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-108s1c1
Sequence:CCGGCGTGCCATCATGGACAAGAAACTCGAGTTTCTTGTCCATGATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1255s1c1
Sequence:CCGGGCCCACTTATGATGTACATTTCTCGAGAAATGTACATCATAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1133s1c1
Sequence:CCGGGCAGATGATCACCATCCACTTCTCGAGAAGTGGATGGTGATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-893s21c1
Sequence:CCGGCAAGTTCAGTAAGTCAGCCAACTCGAGTTGGCTGACTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-108s21c1
Sequence:CCGGCGTGCCATCATGGACAAGAAACTCGAGTTTCTTGTCCATGATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007907.1-1310s21c1
Sequence:CCGGCTATGCCTTTGGTAGAGTGTTCTCGAGAACACTCTACCAAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-1255s21c1
Sequence:CCGGGCCCACTTATGATGTACATTTCTCGAGAAATGTACATCATAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-1133s21c1
Sequence:CCGGGCAGATGATCACCATCCACTTCTCGAGAAGTGGATGGTGATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007907
VALIDATED
EEF2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-893s1c1
Sequence:CCGGCAAGTTCAGTAAGTCAGCCAACTCGAGTTGGCTGACTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1310s1c1
Sequence:CCGGCTATGCCTTTGGTAGAGTGTTCTCGAGAACACTCTACCAAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-108s1c1
Sequence:CCGGCGTGCCATCATGGACAAGAAACTCGAGTTTCTTGTCCATGATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1255s1c1
Sequence:CCGGGCCCACTTATGATGTACATTTCTCGAGAAATGTACATCATAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007907.1-1133s1c1
Sequence:CCGGGCAGATGATCACCATCCACTTCTCGAGAAGTGGATGGTGATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-893s21c1
Sequence:CCGGCAAGTTCAGTAAGTCAGCCAACTCGAGTTGGCTGACTTACTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-108s21c1
Sequence:CCGGCGTGCCATCATGGACAAGAAACTCGAGTTTCTTGTCCATGATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007907.1-1310s21c1
Sequence:CCGGCTATGCCTTTGGTAGAGTGTTCTCGAGAACACTCTACCAAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-1255s21c1
Sequence:CCGGGCCCACTTATGATGTACATTTCTCGAGAAATGTACATCATAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007907.1-1133s21c1
Sequence:CCGGGCAGATGATCACCATCCACTTCTCGAGAAGTGGATGGTGATCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001961
VALIDATED
EEF2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation elongation factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-1409s1c1
Sequence:CCGGCCAGAGAACAATCTTGATGATCTCGAGATCATCAAGATTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-1243s1c1
Sequence:CCGGGCCCTCTTATGATGTATATTTCTCGAGAAATATACATCATAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001961.2-2619s1c1
Sequence:CCGGCTGGACAACTTCCTGGACAAACTCGAGTTTGTCCAGGAAGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-2075s1c1
Sequence:CCGGGCAGTACCTCAACGAGATCAACTCGAGTTGATCTCGTTGAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-975s1c1
Sequence:CCGGGCGATCATGAATTTCAAGAAACTCGAGTTTCTTGAAATTCATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-1258s21c1
Sequence:CCGGGCCCTCTTATGATGTATATTTCTCGAGAAATATACATCATAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001961.3-2634s21c1
Sequence:CCGGCTGGACAACTTCCTGGACAAACTCGAGTTTGTCCAGGAAGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-990s21c1
Sequence:CCGGGCGATCATGAATTTCAAGAAACTCGAGTTTCTTGAAATTCATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-2090s21c1
Sequence:CCGGGCAGTACCTCAACGAGATCAACTCGAGTTGATCTCGTTGAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-1424s21c1
Sequence:CCGGCCAGAGAACAATCTTGATGATCTCGAGATCATCAAGATTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001961
VALIDATED
EEF2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation elongation factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-1409s1c1
Sequence:CCGGCCAGAGAACAATCTTGATGATCTCGAGATCATCAAGATTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-1243s1c1
Sequence:CCGGGCCCTCTTATGATGTATATTTCTCGAGAAATATACATCATAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001961.2-2619s1c1
Sequence:CCGGCTGGACAACTTCCTGGACAAACTCGAGTTTGTCCAGGAAGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-2075s1c1
Sequence:CCGGGCAGTACCTCAACGAGATCAACTCGAGTTGATCTCGTTGAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-975s1c1
Sequence:CCGGGCGATCATGAATTTCAAGAAACTCGAGTTTCTTGAAATTCATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-1258s21c1
Sequence:CCGGGCCCTCTTATGATGTATATTTCTCGAGAAATATACATCATAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001961.3-2634s21c1
Sequence:CCGGCTGGACAACTTCCTGGACAAACTCGAGTTTGTCCAGGAAGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-990s21c1
Sequence:CCGGGCGATCATGAATTTCAAGAAACTCGAGTTTCTTGAAATTCATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-2090s21c1
Sequence:CCGGGCAGTACCTCAACGAGATCAACTCGAGTTGATCTCGTTGAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-1424s21c1
Sequence:CCGGCCAGAGAACAATCTTGATGATCTCGAGATCATCAAGATTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001961
VALIDATED
EEF2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation elongation factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-1409s1c1
Sequence:CCGGCCAGAGAACAATCTTGATGATCTCGAGATCATCAAGATTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-1243s1c1
Sequence:CCGGGCCCTCTTATGATGTATATTTCTCGAGAAATATACATCATAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001961.2-2619s1c1
Sequence:CCGGCTGGACAACTTCCTGGACAAACTCGAGTTTGTCCAGGAAGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-2075s1c1
Sequence:CCGGGCAGTACCTCAACGAGATCAACTCGAGTTGATCTCGTTGAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001961.2-975s1c1
Sequence:CCGGGCGATCATGAATTTCAAGAAACTCGAGTTTCTTGAAATTCATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-1258s21c1
Sequence:CCGGGCCCTCTTATGATGTATATTTCTCGAGAAATATACATCATAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001961.3-2634s21c1
Sequence:CCGGCTGGACAACTTCCTGGACAAACTCGAGTTTGTCCAGGAAGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-990s21c1
Sequence:CCGGGCGATCATGAATTTCAAGAAACTCGAGTTTCTTGAAATTCATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-2090s21c1
Sequence:CCGGGCAGTACCTCAACGAGATCAACTCGAGTTGATCTCGTTGAGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001961.3-1424s21c1
Sequence:CCGGCCAGAGAACAATCTTGATGATCTCGAGATCATCAAGATTGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks