EMAIL THIS PAGE TO A FRIEND

EEF2K

eukaryotic elongation factor-2 kinase

Synonyms: HSU93850 eEF-2K
UniProtKB ID: O00418, Q8N588
Gene ID:
Human(29904) Summary: This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
Mouse(13631) eukaryotic elongation factor-2 kinase
Rat(25435) eukaryotic elongation factor-2 kinase
Zebrafish(437013) elongation factor-2 kinase
dog(479812) eukaryotic elongation factor-2 kinase
cow(521730) eukaryotic elongation factor-2 kinase
Horse(100058387) eukaryotic elongation factor-2 kinase
domestic cat(101101433) eukaryotic elongation factor-2 kinase
chicken(416619) eukaryotic elongation factor-2 kinase
sheep(101103447) eukaryotic elongation factor-2 kinase
Domestic Rabbit(100347896) eukaryotic elongation factor-2 kinase
domestic guinea pig(100718806) eukaryotic elongation factor-2 kinase
naked mole-rat(101709310) eukaryotic elongation factor-2 kinase
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T182 Tyrphostin A9 solid human, mouse pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1051 MCF10A CELLS EEF2K (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013302 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
12-560 EF2tide 1 mg, EF2tide primarily used in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013302 siRNAs that have been validated in the lab human pricing
NM_012947 Rosetta Predictions rat pricing
NM_007908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013302 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060065 validated 2218
1 SASI_Hs01_00060064 validated 634
2 SASI_Hs01_00060066 predicted 1103
3 SASI_Hs01_00060067 predicted 1858
4 SASI_Hs01_00060068 predicted 1848
5 SASI_Hs01_00060069 predicted 929
6 SASI_Hs01_00060070 predicted 1719
7 SASI_Hs01_00060071 predicted 1874
8 SASI_Hs01_00060073 predicted 1018
9 SASI_Hs02_00344582 predicted 650
10 SASI_Hs01_00060072 predicted 2447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035610 predicted 1232
2 SASI_Rn01_00035612 predicted 1886
3 SASI_Rn01_00035613 predicted 1783
4 SASI_Rn01_00035614 predicted 876
5 SASI_Rn02_00260517 predicted 789
6 SASI_Rn01_00035617 predicted 614
7 SASI_Rn02_00260518 predicted 697
8 SASI_Rn02_00260519 predicted 907
9 SASI_Rn02_00260520 predicted 1497
10 SASI_Rn02_00260521 predicted 628
11 SASI_Rn01_00035609 predicted 2461
12 SASI_Rn01_00035611 predicted 2453
13 SASI_Rn01_00035615 predicted 1156
14 SASI_Rn01_00035616 predicted 458
15 SASI_Rn01_00035618 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094012 predicted 2344
2 SASI_Mm01_00094013 predicted 1172
3 SASI_Mm01_00094014 predicted 1523
4 SASI_Mm01_00094015 predicted 384
5 SASI_Mm01_00094016 predicted 1148
6 SASI_Mm01_00094017 predicted 903
7 SASI_Mm01_00094018 predicted 928
8 SASI_Mm01_00094019 predicted 2322
9 SASI_Mm01_00094020 predicted 1022
10 SASI_Mm01_00094021 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007908
VALIDATED
EEF2K MISSION shRNA Bacterial Glycerol Stock
eukaryotic elongation factor-2 kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007908.3-2603s21c1
Sequence:CCGGTTGCAGCTGGCCGAGACATTACTCGAGTAATGTCTCGGCCAGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-387s21c1
Sequence:CCGGTGACGATGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-2227s21c1
Sequence:CCGGGAGACAACAGACTGCGATGAACTCGAGTTCATCGCAGTCTGTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-1207s21c1
Sequence:CCGGGCTCTCTTCTTCTACTCTCATCTCGAGATGAGAGTAGAAGAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-455s21c1
Sequence:CCGGCCAAAGTCCAGAGCTACTATACTCGAGTATAGTAGCTCTGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007908.3-2732s21c1
Sequence:CCGGAGATGTAAGCAAGTATCTTTCCTCGAGGAAAGATACTTGCTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-1032s21c1
Sequence:CCGGTGATGACAACATCCGACTAACCTCGAGGTTAGTCGGATGTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-1207s1c1
Sequence:CCGGGCTCTCTTCTTCTACTCTCATCTCGAGATGAGAGTAGAAGAAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-1030s1c1
Sequence:CCGGCGTGATGACAACATCCGACTACTCGAGTAGTCGGATGTTGTCATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-2349s1c1
Sequence:CCGGCCAAAGATCAGGAGATTTGTACTCGAGTACAAATCTCCTGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007908
VALIDATED
EEF2K MISSION shRNA shRNA Plasmid DNA
eukaryotic elongation factor-2 kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007908.3-2603s21c1
Sequence:CCGGTTGCAGCTGGCCGAGACATTACTCGAGTAATGTCTCGGCCAGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-387s21c1
Sequence:CCGGTGACGATGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-2227s21c1
Sequence:CCGGGAGACAACAGACTGCGATGAACTCGAGTTCATCGCAGTCTGTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-1207s21c1
Sequence:CCGGGCTCTCTTCTTCTACTCTCATCTCGAGATGAGAGTAGAAGAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-455s21c1
Sequence:CCGGCCAAAGTCCAGAGCTACTATACTCGAGTATAGTAGCTCTGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007908.3-2732s21c1
Sequence:CCGGAGATGTAAGCAAGTATCTTTCCTCGAGGAAAGATACTTGCTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-1032s21c1
Sequence:CCGGTGATGACAACATCCGACTAACCTCGAGGTTAGTCGGATGTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-1207s1c1
Sequence:CCGGGCTCTCTTCTTCTACTCTCATCTCGAGATGAGAGTAGAAGAAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-1030s1c1
Sequence:CCGGCGTGATGACAACATCCGACTACTCGAGTAGTCGGATGTTGTCATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-2349s1c1
Sequence:CCGGCCAAAGATCAGGAGATTTGTACTCGAGTACAAATCTCCTGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007908
VALIDATED
EEF2K MISSION shRNA Lentiviral Transduction Particles
eukaryotic elongation factor-2 kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007908.3-2603s21c1
Sequence:CCGGTTGCAGCTGGCCGAGACATTACTCGAGTAATGTCTCGGCCAGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-387s21c1
Sequence:CCGGTGACGATGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-2227s21c1
Sequence:CCGGGAGACAACAGACTGCGATGAACTCGAGTTCATCGCAGTCTGTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-1207s21c1
Sequence:CCGGGCTCTCTTCTTCTACTCTCATCTCGAGATGAGAGTAGAAGAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-455s21c1
Sequence:CCGGCCAAAGTCCAGAGCTACTATACTCGAGTATAGTAGCTCTGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007908.3-2732s21c1
Sequence:CCGGAGATGTAAGCAAGTATCTTTCCTCGAGGAAAGATACTTGCTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007908.3-1032s21c1
Sequence:CCGGTGATGACAACATCCGACTAACCTCGAGGTTAGTCGGATGTTGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-1207s1c1
Sequence:CCGGGCTCTCTTCTTCTACTCTCATCTCGAGATGAGAGTAGAAGAAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-1030s1c1
Sequence:CCGGCGTGATGACAACATCCGACTACTCGAGTAGTCGGATGTTGTCATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007908.2-2349s1c1
Sequence:CCGGCCAAAGATCAGGAGATTTGTACTCGAGTACAAATCTCCTGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013302
VALIDATED
EEF2K MISSION shRNA Bacterial Glycerol Stock
eukaryotic elongation factor-2 kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-1417s1c1
Sequence:CCGGCTCATGCCTGCAACCGGATTTCTCGAGAAATCCGGTTGCAGGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013302.3-637s1c1
Sequence:CCGGATGTCAATTCCAAGGTTAATACTCGAGTATTAACCTTGGAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-637s21c1
Sequence:CCGGATGTCAATTCCAAGGTTAATACTCGAGTATTAACCTTGGAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-4775s21c1
Sequence:CCGGTCCCTTGGACCACCCATAAATCTCGAGATTTATGGGTGGTCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-2269s21c1
Sequence:CCGGCCAAAGGATTTGATTACTTACCTCGAGGTAAGTAATCAAATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-1860s21c1
Sequence:CCGGCATGGCCACTCATACAGTAATCTCGAGATTACTGTATGAGTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-1417s21c1
Sequence:CCGGCTCATGCCTGCAACCGGATTTCTCGAGAAATCCGGTTGCAGGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013302.2-1449s1c1
Sequence:CCGGGCATCCAGAGACCATGATCATCTCGAGATGATCATGGTCTCTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013302.2-495s1c1
Sequence:CCGGCTGGAAGATATTGCCACCGAACTCGAGTTCGGTGGCAATATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-3074s1c1
Sequence:CCGGCCCATAAATGACAGTGACTTTCTCGAGAAAGTCACTGTCATTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-281s1c1
Sequence:CCGGCGATGAGGAAGGTTACTTCATCTCGAGATGAAGTAACCTTCCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-1565s1c1
Sequence:CCGGCCACTCATACAGTAATCGGAACTCGAGTTCCGATTACTGTATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-5662s1c1
Sequence:CCGGGCTTCTTTAAGGGCCCTTAAACTCGAGTTTAAGGGCCCTTAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-4105s1c1
Sequence:CCGGCCAGACAATGGCGATTGTTATCTCGAGATAACAATCGCCATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-2891s1c1
Sequence:CCGGGCTTGAAGAAGCAGCCTAATGCTCGAGCATTAGGCTGCTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013302
VALIDATED
EEF2K MISSION shRNA shRNA Plasmid DNA
eukaryotic elongation factor-2 kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-1417s1c1
Sequence:CCGGCTCATGCCTGCAACCGGATTTCTCGAGAAATCCGGTTGCAGGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013302.3-637s1c1
Sequence:CCGGATGTCAATTCCAAGGTTAATACTCGAGTATTAACCTTGGAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-637s21c1
Sequence:CCGGATGTCAATTCCAAGGTTAATACTCGAGTATTAACCTTGGAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-4775s21c1
Sequence:CCGGTCCCTTGGACCACCCATAAATCTCGAGATTTATGGGTGGTCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-2269s21c1
Sequence:CCGGCCAAAGGATTTGATTACTTACCTCGAGGTAAGTAATCAAATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-1860s21c1
Sequence:CCGGCATGGCCACTCATACAGTAATCTCGAGATTACTGTATGAGTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-1417s21c1
Sequence:CCGGCTCATGCCTGCAACCGGATTTCTCGAGAAATCCGGTTGCAGGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013302.2-1449s1c1
Sequence:CCGGGCATCCAGAGACCATGATCATCTCGAGATGATCATGGTCTCTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013302.2-495s1c1
Sequence:CCGGCTGGAAGATATTGCCACCGAACTCGAGTTCGGTGGCAATATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-3074s1c1
Sequence:CCGGCCCATAAATGACAGTGACTTTCTCGAGAAAGTCACTGTCATTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-281s1c1
Sequence:CCGGCGATGAGGAAGGTTACTTCATCTCGAGATGAAGTAACCTTCCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-1565s1c1
Sequence:CCGGCCACTCATACAGTAATCGGAACTCGAGTTCCGATTACTGTATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-5662s1c1
Sequence:CCGGGCTTCTTTAAGGGCCCTTAAACTCGAGTTTAAGGGCCCTTAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-4105s1c1
Sequence:CCGGCCAGACAATGGCGATTGTTATCTCGAGATAACAATCGCCATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-2891s1c1
Sequence:CCGGGCTTGAAGAAGCAGCCTAATGCTCGAGCATTAGGCTGCTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013302
VALIDATED
EEF2K MISSION shRNA Lentiviral Transduction Particles
eukaryotic elongation factor-2 kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-1417s1c1
Sequence:CCGGCTCATGCCTGCAACCGGATTTCTCGAGAAATCCGGTTGCAGGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013302.3-637s1c1
Sequence:CCGGATGTCAATTCCAAGGTTAATACTCGAGTATTAACCTTGGAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-637s21c1
Sequence:CCGGATGTCAATTCCAAGGTTAATACTCGAGTATTAACCTTGGAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-4775s21c1
Sequence:CCGGTCCCTTGGACCACCCATAAATCTCGAGATTTATGGGTGGTCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-2269s21c1
Sequence:CCGGCCAAAGGATTTGATTACTTACCTCGAGGTAAGTAATCAAATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-1860s21c1
Sequence:CCGGCATGGCCACTCATACAGTAATCTCGAGATTACTGTATGAGTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_013302.3-1417s21c1
Sequence:CCGGCTCATGCCTGCAACCGGATTTCTCGAGAAATCCGGTTGCAGGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013302.2-1449s1c1
Sequence:CCGGGCATCCAGAGACCATGATCATCTCGAGATGATCATGGTCTCTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013302.2-495s1c1
Sequence:CCGGCTGGAAGATATTGCCACCGAACTCGAGTTCGGTGGCAATATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-3074s1c1
Sequence:CCGGCCCATAAATGACAGTGACTTTCTCGAGAAAGTCACTGTCATTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-281s1c1
Sequence:CCGGCGATGAGGAAGGTTACTTCATCTCGAGATGAAGTAACCTTCCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_013302.2-1565s1c1
Sequence:CCGGCCACTCATACAGTAATCGGAACTCGAGTTCCGATTACTGTATGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-5662s1c1
Sequence:CCGGGCTTCTTTAAGGGCCCTTAAACTCGAGTTTAAGGGCCCTTAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-4105s1c1
Sequence:CCGGCCAGACAATGGCGATTGTTATCTCGAGATAACAATCGCCATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013302.3-2891s1c1
Sequence:CCGGGCTTGAAGAAGCAGCCTAATGCTCGAGCATTAGGCTGCTTCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks