EMAIL THIS PAGE TO A FRIEND

EEFSEC

eukaryotic elongation factor, selenocysteine-tRNA-specific

58 Gene Product Result for
Synonyms: EFSEC SELB
UniProtKB ID: P57772
Gene ID:
Mouse(65967) eukaryotic elongation factor, selenocysteine-tRNA-specific
Rat(500255) eukaryotic elongation factor, selenocysteine-tRNA-specific
Zebrafish(641497) eukaryotic elongation factor, selenocysteine-tRNA-specific
cow(532824) eukaryotic elongation factor, selenocysteine-tRNA-specific
Horse(100054326) eukaryotic elongation factor, selenocysteine-tRNA-specific
domestic cat(101088913) eukaryotic elongation factor, selenocysteine-tRNA-specific
dog(476514) eukaryotic elongation factor, selenocysteine-tRNA-specific
chicken(416021) eukaryotic elongation factor, selenocysteine-tRNA-specific
naked mole-rat(101705575) eukaryotic elongation factor, selenocysteine-tRNA-specific
domestic guinea pig(100721016) eukaryotic elongation factor, selenocysteine-tRNA-specific
sheep(101113540) eukaryotic elongation factor, selenocysteine-tRNA-specific
Domestic Rabbit(100338901) eukaryotic elongation factor, selenocysteine-tRNA-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021937 Rosetta Predictions human pricing
NM_001109249 Rosetta Predictions rat pricing
NM_023060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197897 predicted 1407
2 SASI_Hs01_00197898 predicted 1113
3 SASI_Hs01_00197899 predicted 1064
4 SASI_Hs01_00197900 predicted 496
5 SASI_Hs02_00355249 predicted 670
6 SASI_Hs01_00197901 predicted 1107
7 SASI_Hs01_00197902 predicted 1041
8 SASI_Hs01_00197903 predicted 1438
9 SASI_Hs02_00355250 predicted 535
10 SASI_Hs01_00197904 predicted 1137
11 SASI_Hs01_00197905 predicted 1495
12 SASI_Hs01_00197906 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246554 predicted 613
2 SASI_Rn02_00246555 predicted 318
3 SASI_Rn02_00246556 predicted 499
4 SASI_Rn02_00246557 predicted 1330
5 SASI_Rn02_00246558 predicted 441
6 SASI_Rn02_00246559 predicted 600
7 SASI_Rn02_00246560 predicted 1330
8 SASI_Rn02_00246561 predicted 1074
9 SASI_Rn02_00246562 predicted 322
10 SASI_Rn02_00246563 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189049 predicted 1313
2 SASI_Mm01_00189050 predicted 1129
3 SASI_Mm01_00189051 predicted 913
4 SASI_Mm01_00189052 predicted 335
5 SASI_Mm02_00326769 predicted 644
6 SASI_Mm01_00189054 predicted 314
7 SASI_Mm01_00189055 predicted 342
8 SASI_Mm01_00189056 predicted 1100
9 SASI_Mm01_00189057 predicted 1786
10 SASI_Mm01_00189058 predicted 1043
11 SASI_Mm01_00189053 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023060
VALIDATED
EEFSEC MISSION shRNA Bacterial Glycerol Stock
eukaryotic elongation factor, selenocysteine-tRNA-specific
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-1889s1c1
Sequence:CCGGCACTGCCATTGCACTGTTATTCTCGAGAATAACAGTGCAATGGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-331s1c1
Sequence:CCGGGATTTGATGATGCTCGTGATTCTCGAGAATCACGAGCATCATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-2251s1c1
Sequence:CCGGGACCTTGAAGAATGGAGGTTTCTCGAGAAACCTCCATTCTTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-2491s1c1
Sequence:CCGGGAACTGACCAACGAAGGAAATCTCGAGATTTCCTTCGTTGGTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023060.3-2509s21c1
Sequence:CCGGGAACTGACCAACGAAGGAAATCTCGAGATTTCCTTCGTTGGTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023060.3-2269s21c1
Sequence:CCGGGACCTTGAAGAATGGAGGTTTCTCGAGAAACCTCCATTCTTCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-349s21c1
Sequence:CCGGGATTTGATGATGCTCGTGATTCTCGAGAATCACGAGCATCATCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-1313s21c1
Sequence:CCGGCCAGACTAGATGCCGACATTCCTCGAGGAATGTCGGCATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-1907s21c1
Sequence:CCGGCACTGCCATTGCACTGTTATTCTCGAGAATAACAGTGCAATGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023060
VALIDATED
EEFSEC MISSION shRNA shRNA Plasmid DNA
eukaryotic elongation factor, selenocysteine-tRNA-specific
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-1889s1c1
Sequence:CCGGCACTGCCATTGCACTGTTATTCTCGAGAATAACAGTGCAATGGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-331s1c1
Sequence:CCGGGATTTGATGATGCTCGTGATTCTCGAGAATCACGAGCATCATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-2251s1c1
Sequence:CCGGGACCTTGAAGAATGGAGGTTTCTCGAGAAACCTCCATTCTTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-2491s1c1
Sequence:CCGGGAACTGACCAACGAAGGAAATCTCGAGATTTCCTTCGTTGGTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023060.3-2509s21c1
Sequence:CCGGGAACTGACCAACGAAGGAAATCTCGAGATTTCCTTCGTTGGTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023060.3-2269s21c1
Sequence:CCGGGACCTTGAAGAATGGAGGTTTCTCGAGAAACCTCCATTCTTCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-349s21c1
Sequence:CCGGGATTTGATGATGCTCGTGATTCTCGAGAATCACGAGCATCATCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-1313s21c1
Sequence:CCGGCCAGACTAGATGCCGACATTCCTCGAGGAATGTCGGCATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-1907s21c1
Sequence:CCGGCACTGCCATTGCACTGTTATTCTCGAGAATAACAGTGCAATGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023060
VALIDATED
EEFSEC MISSION shRNA Lentiviral Transduction Particles
eukaryotic elongation factor, selenocysteine-tRNA-specific
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-1889s1c1
Sequence:CCGGCACTGCCATTGCACTGTTATTCTCGAGAATAACAGTGCAATGGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-331s1c1
Sequence:CCGGGATTTGATGATGCTCGTGATTCTCGAGAATCACGAGCATCATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-2251s1c1
Sequence:CCGGGACCTTGAAGAATGGAGGTTTCTCGAGAAACCTCCATTCTTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023060.2-2491s1c1
Sequence:CCGGGAACTGACCAACGAAGGAAATCTCGAGATTTCCTTCGTTGGTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023060.3-2509s21c1
Sequence:CCGGGAACTGACCAACGAAGGAAATCTCGAGATTTCCTTCGTTGGTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023060.3-2269s21c1
Sequence:CCGGGACCTTGAAGAATGGAGGTTTCTCGAGAAACCTCCATTCTTCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-349s21c1
Sequence:CCGGGATTTGATGATGCTCGTGATTCTCGAGAATCACGAGCATCATCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-1313s21c1
Sequence:CCGGCCAGACTAGATGCCGACATTCCTCGAGGAATGTCGGCATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023060.3-1907s21c1
Sequence:CCGGCACTGCCATTGCACTGTTATTCTCGAGAATAACAGTGCAATGGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021937
VALIDATED
EEFSEC MISSION shRNA Bacterial Glycerol Stock
eukaryotic elongation factor, selenocysteine-tRNA-specific
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021937.2-995s1c1
Sequence:CCGGGATAACTTTGACCAGGAGCCTCTCGAGAGGCTCCTGGTCAAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021937.2-250s1c1
Sequence:CCGGCCAGATCATTGATCTGATGATCTCGAGATCATCAGATCAATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-1375s1c1
Sequence:CCGGGATGGATGACTACAGTGTGATCTCGAGATCACACTGTAGTCATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-433s1c1
Sequence:CCGGGAAGACCCTAGAGAACACCAACTCGAGTTGGTGTTCTCTAGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-563s1c1
Sequence:CCGGCAGATTTCCATCCCAACGAGACTCGAGTCTCGTTGGGATGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021937.2-1504s1c1
Sequence:CCGGCGGCAAGTTCAAGATCCACATCTCGAGATGTGGATCTTGAACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-564s21c1
Sequence:CCGGTTCCGAGGTGCACCGATTATACTCGAGTATAATCGGTGCACCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-1770s21c1
Sequence:CCGGAGCCTGACTTTCAAGCGTTATCTCGAGATAACGCTTGAAAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021937.3-1878s21c1
Sequence:CCGGTGCTGTGCCAAATCCCAACCACTCGAGTGGTTGGGATTTGGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-637s21c1
Sequence:CCGGAGGGCATTCCAGAGCTCATTGCTCGAGCAATGAGCTCTGGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-503s21c1
Sequence:CCGGGAGACAGGCAGCAATTGATAACTCGAGTTATCAATTGCTGCCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021937
VALIDATED
EEFSEC MISSION shRNA shRNA Plasmid DNA
eukaryotic elongation factor, selenocysteine-tRNA-specific
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021937.2-995s1c1
Sequence:CCGGGATAACTTTGACCAGGAGCCTCTCGAGAGGCTCCTGGTCAAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021937.2-250s1c1
Sequence:CCGGCCAGATCATTGATCTGATGATCTCGAGATCATCAGATCAATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-1375s1c1
Sequence:CCGGGATGGATGACTACAGTGTGATCTCGAGATCACACTGTAGTCATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-433s1c1
Sequence:CCGGGAAGACCCTAGAGAACACCAACTCGAGTTGGTGTTCTCTAGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-563s1c1
Sequence:CCGGCAGATTTCCATCCCAACGAGACTCGAGTCTCGTTGGGATGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021937.2-1504s1c1
Sequence:CCGGCGGCAAGTTCAAGATCCACATCTCGAGATGTGGATCTTGAACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-564s21c1
Sequence:CCGGTTCCGAGGTGCACCGATTATACTCGAGTATAATCGGTGCACCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-1770s21c1
Sequence:CCGGAGCCTGACTTTCAAGCGTTATCTCGAGATAACGCTTGAAAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021937.3-1878s21c1
Sequence:CCGGTGCTGTGCCAAATCCCAACCACTCGAGTGGTTGGGATTTGGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-637s21c1
Sequence:CCGGAGGGCATTCCAGAGCTCATTGCTCGAGCAATGAGCTCTGGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-503s21c1
Sequence:CCGGGAGACAGGCAGCAATTGATAACTCGAGTTATCAATTGCTGCCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021937
VALIDATED
EEFSEC MISSION shRNA Lentiviral Transduction Particles
eukaryotic elongation factor, selenocysteine-tRNA-specific
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021937.2-995s1c1
Sequence:CCGGGATAACTTTGACCAGGAGCCTCTCGAGAGGCTCCTGGTCAAAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021937.2-250s1c1
Sequence:CCGGCCAGATCATTGATCTGATGATCTCGAGATCATCAGATCAATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-1375s1c1
Sequence:CCGGGATGGATGACTACAGTGTGATCTCGAGATCACACTGTAGTCATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-433s1c1
Sequence:CCGGGAAGACCCTAGAGAACACCAACTCGAGTTGGTGTTCTCTAGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021937.2-563s1c1
Sequence:CCGGCAGATTTCCATCCCAACGAGACTCGAGTCTCGTTGGGATGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021937.2-1504s1c1
Sequence:CCGGCGGCAAGTTCAAGATCCACATCTCGAGATGTGGATCTTGAACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-564s21c1
Sequence:CCGGTTCCGAGGTGCACCGATTATACTCGAGTATAATCGGTGCACCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-1770s21c1
Sequence:CCGGAGCCTGACTTTCAAGCGTTATCTCGAGATAACGCTTGAAAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021937.3-1878s21c1
Sequence:CCGGTGCTGTGCCAAATCCCAACCACTCGAGTGGTTGGGATTTGGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-637s21c1
Sequence:CCGGAGGGCATTCCAGAGCTCATTGCTCGAGCAATGAGCTCTGGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021937.3-503s21c1
Sequence:CCGGGAGACAGGCAGCAATTGATAACTCGAGTTATCAATTGCTGCCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks