EMAIL THIS PAGE TO A FRIEND

EEPD1

endonuclease/exonuclease/phosphatase family domain containing 1

49 Gene Product Result for
Synonyms: HSPC107
UniProtKB ID: Q7L9B9, Q96K64, Q9C0F7
Gene ID:
Mouse(67484) endonuclease/exonuclease/phosphatase family domain containing 1
Rat(315500) endonuclease/exonuclease/phosphatase family domain containing 1
sheep(101116563) endonuclease/exonuclease/phosphatase family domain containing 1
Domestic Rabbit(100350823) endonuclease/exonuclease/phosphatase family domain containing 1
domestic guinea pig(100714673) endonuclease/exonuclease/phosphatase family domain containing 1
naked mole-rat(101719795) endonuclease/exonuclease/phosphatase family domain containing 1
Zebrafish(402965) endonuclease/exonuclease/phosphatase family domain containing 1
chicken(420740) endonuclease/exonuclease/phosphatase family domain containing 1
domestic cat(101100292) endonuclease/exonuclease/phosphatase family domain containing 1
cow(511767) endonuclease/exonuclease/phosphatase family domain containing 1
dog(482399) endonuclease/exonuclease/phosphatase family domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030636 Rosetta Predictions human pricing
NM_001014088 Rosetta Predictions rat pricing
NM_026189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358210 predicted 915
2 SASI_Hs01_00059626 predicted 1510
3 SASI_Hs01_00059627 predicted 2341
4 SASI_Hs01_00059628 predicted 1819
5 SASI_Hs01_00059629 predicted 2230
6 SASI_Hs01_00059630 predicted 835
7 SASI_Hs02_00358211 predicted 2093
8 SASI_Hs01_00059631 predicted 896
9 SASI_Hs01_00059632 predicted 1785
10 SASI_Hs01_00059635 predicted 1682
11 SASI_Hs01_00059633 predicted 1174
12 SASI_Hs01_00059634 predicted 2313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071268 predicted 1838
2 SASI_Rn01_00071270 predicted 544
3 SASI_Rn01_00071271 predicted 921
4 SASI_Rn01_00071272 predicted 1835
5 SASI_Rn02_00201514 predicted 1418
6 SASI_Rn01_00071274 predicted 1403
7 SASI_Rn01_00071275 predicted 275
8 SASI_Rn01_00071276 predicted 1738
9 SASI_Rn01_00071277 predicted 1214
10 SASI_Rn02_00201515 predicted 305
11 SASI_Rn01_00071269 predicted 548
12 SASI_Rn01_00071273 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152224 predicted 1088
2 SASI_Mm01_00152225 predicted 2130
3 SASI_Mm01_00152226 predicted 2245
4 SASI_Mm01_00152227 predicted 560
5 SASI_Mm01_00152228 predicted 555
6 SASI_Mm01_00152229 predicted 1818
7 SASI_Mm01_00152230 predicted 686
8 SASI_Mm02_00329855 predicted 1338
9 SASI_Mm01_00152231 predicted 1730
10 SASI_Mm01_00152232 predicted 2150
11 SASI_Mm01_00152233 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026189
VALIDATED
EEPD1 MISSION shRNA Bacterial Glycerol Stock
endonuclease/exonuclease/phosphatase family domain containing 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-2434s21c1
Sequence:CCGGGCACTGCTGGCTGATTGTTTACTCGAGTAAACAATCAGCCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026189.3-1734s21c1
Sequence:CCGGCGATTATTGAACTTTGCACTACTCGAGTAGTGCAAAGTTCAATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-1629s21c1
Sequence:CCGGAGATTCAAGGTGGGAAGTAATCTCGAGATTACTTCCCACCTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026189.3-566s21c1
Sequence:CCGGGAATCAGGAGCGGCTAAATATCTCGAGATATTTAGCCGCTCCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-1820s21c1
Sequence:CCGGAGATAGCAATGACTACGATATCTCGAGATATCGTAGTCATTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-512s21c1
Sequence:CCGGCCTGTCACATAACCGCAAGTTCTCGAGAACTTGCGGTTATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-2296s1c1
Sequence:CCGGGTCCACTTTGTGAACACTTTACTCGAGTAAAGTGTTCACAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-649s1c1
Sequence:CCGGGCATCGTGGAATACCGAGAATCTCGAGATTCTCGGTATTCCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-512s1c1
Sequence:CCGGCCTGTCACATAACCGCAAGTTCTCGAGAACTTGCGGTTATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026189.3-1734s1c1
Sequence:CCGGCGATTATTGAACTTTGCACTACTCGAGTAGTGCAAAGTTCAATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-2149s1c1
Sequence:CCGGCCAACATTAAACATGAGCGATCTCGAGATCGCTCATGTTTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026189
VALIDATED
EEPD1 MISSION shRNA shRNA Plasmid DNA
endonuclease/exonuclease/phosphatase family domain containing 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-2434s21c1
Sequence:CCGGGCACTGCTGGCTGATTGTTTACTCGAGTAAACAATCAGCCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026189.3-1734s21c1
Sequence:CCGGCGATTATTGAACTTTGCACTACTCGAGTAGTGCAAAGTTCAATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-1629s21c1
Sequence:CCGGAGATTCAAGGTGGGAAGTAATCTCGAGATTACTTCCCACCTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026189.3-566s21c1
Sequence:CCGGGAATCAGGAGCGGCTAAATATCTCGAGATATTTAGCCGCTCCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-1820s21c1
Sequence:CCGGAGATAGCAATGACTACGATATCTCGAGATATCGTAGTCATTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-512s21c1
Sequence:CCGGCCTGTCACATAACCGCAAGTTCTCGAGAACTTGCGGTTATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-2296s1c1
Sequence:CCGGGTCCACTTTGTGAACACTTTACTCGAGTAAAGTGTTCACAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-649s1c1
Sequence:CCGGGCATCGTGGAATACCGAGAATCTCGAGATTCTCGGTATTCCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-512s1c1
Sequence:CCGGCCTGTCACATAACCGCAAGTTCTCGAGAACTTGCGGTTATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026189.3-1734s1c1
Sequence:CCGGCGATTATTGAACTTTGCACTACTCGAGTAGTGCAAAGTTCAATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-2149s1c1
Sequence:CCGGCCAACATTAAACATGAGCGATCTCGAGATCGCTCATGTTTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026189
VALIDATED
EEPD1 MISSION shRNA Lentiviral Transduction Particles
endonuclease/exonuclease/phosphatase family domain containing 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-2434s21c1
Sequence:CCGGGCACTGCTGGCTGATTGTTTACTCGAGTAAACAATCAGCCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026189.3-1734s21c1
Sequence:CCGGCGATTATTGAACTTTGCACTACTCGAGTAGTGCAAAGTTCAATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-1629s21c1
Sequence:CCGGAGATTCAAGGTGGGAAGTAATCTCGAGATTACTTCCCACCTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026189.3-566s21c1
Sequence:CCGGGAATCAGGAGCGGCTAAATATCTCGAGATATTTAGCCGCTCCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-1820s21c1
Sequence:CCGGAGATAGCAATGACTACGATATCTCGAGATATCGTAGTCATTGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026189.3-512s21c1
Sequence:CCGGCCTGTCACATAACCGCAAGTTCTCGAGAACTTGCGGTTATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-2296s1c1
Sequence:CCGGGTCCACTTTGTGAACACTTTACTCGAGTAAAGTGTTCACAAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-649s1c1
Sequence:CCGGGCATCGTGGAATACCGAGAATCTCGAGATTCTCGGTATTCCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-512s1c1
Sequence:CCGGCCTGTCACATAACCGCAAGTTCTCGAGAACTTGCGGTTATGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026189.3-1734s1c1
Sequence:CCGGCGATTATTGAACTTTGCACTACTCGAGTAGTGCAAAGTTCAATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026189.3-2149s1c1
Sequence:CCGGCCAACATTAAACATGAGCGATCTCGAGATCGCTCATGTTTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030636
VALIDATED
EEPD1 MISSION shRNA Bacterial Glycerol Stock
endonuclease/exonuclease/phosphatase family domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030636.2-3556s21c1
Sequence:CCGGGGTCACACCACTGGGTAAATACTCGAGTATTTACCCAGTGGTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-2182s21c1
Sequence:CCGGGAACCCTTGGATTCCGGATAACTCGAGTTATCCGGAATCCAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_030636.2-2108s21c1
Sequence:CCGGGACAACATCTGGATCAGTAAACTCGAGTTTACTGATCCAGATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-1825s21c1
Sequence:CCGGTCACGACCTGACCCTTGTTAACTCGAGTTAACAAGGGTCAGGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-831s21c1
Sequence:CCGGTCGTGGAGTACCGAGAGTATACTCGAGTATACTCTCGGTACTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-1891s1c1
Sequence:CCGGGCGAGCTTTGCACAGACCCTACTCGAGTAGGGTCTGTGCAAAGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-2784s1c1
Sequence:CCGGAGATACATTGAGTGGCGATTTCTCGAGAAATCGCCACTCAATGTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-1969s1c1
Sequence:CCGGCCAGACAGCAATGACTATGATCTCGAGATCATAGTCATTGCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030636.x-2025s1c1
Sequence:CCGGCGCGCACACCTTCACCAACATCTCGAGATGTTGGTGAAGGTGTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030636
VALIDATED
EEPD1 MISSION shRNA shRNA Plasmid DNA
endonuclease/exonuclease/phosphatase family domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030636.2-3556s21c1
Sequence:CCGGGGTCACACCACTGGGTAAATACTCGAGTATTTACCCAGTGGTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-2182s21c1
Sequence:CCGGGAACCCTTGGATTCCGGATAACTCGAGTTATCCGGAATCCAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_030636.2-2108s21c1
Sequence:CCGGGACAACATCTGGATCAGTAAACTCGAGTTTACTGATCCAGATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-1825s21c1
Sequence:CCGGTCACGACCTGACCCTTGTTAACTCGAGTTAACAAGGGTCAGGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-831s21c1
Sequence:CCGGTCGTGGAGTACCGAGAGTATACTCGAGTATACTCTCGGTACTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-1891s1c1
Sequence:CCGGGCGAGCTTTGCACAGACCCTACTCGAGTAGGGTCTGTGCAAAGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-2784s1c1
Sequence:CCGGAGATACATTGAGTGGCGATTTCTCGAGAAATCGCCACTCAATGTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-1969s1c1
Sequence:CCGGCCAGACAGCAATGACTATGATCTCGAGATCATAGTCATTGCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030636.x-2025s1c1
Sequence:CCGGCGCGCACACCTTCACCAACATCTCGAGATGTTGGTGAAGGTGTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030636
VALIDATED
EEPD1 MISSION shRNA Lentiviral Transduction Particles
endonuclease/exonuclease/phosphatase family domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030636.2-3556s21c1
Sequence:CCGGGGTCACACCACTGGGTAAATACTCGAGTATTTACCCAGTGGTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-2182s21c1
Sequence:CCGGGAACCCTTGGATTCCGGATAACTCGAGTTATCCGGAATCCAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_030636.2-2108s21c1
Sequence:CCGGGACAACATCTGGATCAGTAAACTCGAGTTTACTGATCCAGATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-1825s21c1
Sequence:CCGGTCACGACCTGACCCTTGTTAACTCGAGTTAACAAGGGTCAGGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030636.2-831s21c1
Sequence:CCGGTCGTGGAGTACCGAGAGTATACTCGAGTATACTCTCGGTACTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-1891s1c1
Sequence:CCGGGCGAGCTTTGCACAGACCCTACTCGAGTAGGGTCTGTGCAAAGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-2784s1c1
Sequence:CCGGAGATACATTGAGTGGCGATTTCTCGAGAAATCGCCACTCAATGTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_030636.x-1969s1c1
Sequence:CCGGCCAGACAGCAATGACTATGATCTCGAGATCATAGTCATTGCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030636.x-2025s1c1
Sequence:CCGGCGCGCACACCTTCACCAACATCTCGAGATGTTGGTGAAGGTGTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks