EMAIL THIS PAGE TO A FRIEND

EFCAB10

EF-hand calcium binding domain 10

101 Gene Product Result for
UniProtKB ID: A6NFE3
Gene ID:
Mouse(75040) EF-hand calcium binding domain 10
Rat(362727) EF-hand calcium binding domain 10
dog(609764) EF-hand calcium-binding domain-containing protein 10-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077901 MISSION® esiRNA esiRNA targeting mouse 4930504H06Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719448 Rosetta Predictions human pricing
XM_001719450 Rosetta Predictions human pricing
XM_001723041 Rosetta Predictions human pricing
XM_001723043 Rosetta Predictions human pricing
XM_001725807 Rosetta Predictions human pricing
XM_001725809 Rosetta Predictions human pricing
NM_001108706 Rosetta Predictions rat pricing
XM_126856 Rosetta Predictions mouse pricing
XM_914009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00430497 predicted 502
2 SASI_Hs02_00430498 predicted 393
3 SASI_Hs02_00430499 predicted 400
4 SASI_Hs02_00430500 predicted 463
5 SASI_Hs02_00430501 predicted 306
6 SASI_Hs02_00430502 predicted 266
7 SASI_Hs02_00430503 predicted 285
8 SASI_Hs02_00430504 predicted 288
9 SASI_Hs02_00430505 predicted 428
10 SASI_Hs02_00430506 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00430516 predicted 393
2 SASI_Hs02_00430517 predicted 554
3 SASI_Hs02_00430518 predicted 283
4 SASI_Hs02_00430519 predicted 281
5 SASI_Hs02_00430520 predicted 485
6 SASI_Hs02_00430521 predicted 735
7 SASI_Hs02_00430522 predicted 311
8 SASI_Hs02_00430523 predicted 503
9 SASI_Hs02_00430524 predicted 512
10 SASI_Hs02_00430525 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452836 predicted 501
2 SASI_Hs02_00452837 predicted 399
3 SASI_Hs02_00452838 predicted 403
4 SASI_Hs02_00452839 predicted 463
5 SASI_Hs02_00452840 predicted 314
6 SASI_Hs02_00452841 predicted 268
7 SASI_Hs02_00452842 predicted 288
8 SASI_Hs02_00452843 predicted 283
9 SASI_Hs02_00452844 predicted 426
10 SASI_Hs02_00452845 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452856 predicted 387
2 SASI_Hs02_00452857 predicted 563
3 SASI_Hs02_00452858 predicted 278
4 SASI_Hs02_00452859 predicted 284
5 SASI_Hs02_00452860 predicted 482
6 SASI_Hs02_00452861 predicted 732
7 SASI_Hs02_00452862 predicted 310
8 SASI_Hs02_00452863 predicted 502
9 SASI_Hs02_00452864 predicted 512
10 SASI_Hs02_00452865 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470091 predicted 494
2 SASI_Hs02_00470092 predicted 393
3 SASI_Hs02_00470093 predicted 399
4 SASI_Hs02_00470094 predicted 467
5 SASI_Hs02_00470095 predicted 313
6 SASI_Hs02_00470096 predicted 271
7 SASI_Hs02_00470097 predicted 280
8 SASI_Hs02_00470098 predicted 283
9 SASI_Hs02_00470099 predicted 433
10 SASI_Hs02_00470100 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470101 predicted 387
2 SASI_Hs02_00470102 predicted 558
3 SASI_Hs02_00470103 predicted 282
4 SASI_Hs02_00470104 predicted 284
5 SASI_Hs02_00470105 predicted 481
6 SASI_Hs02_00470106 predicted 731
7 SASI_Hs02_00470107 predicted 308
8 SASI_Hs02_00470108 predicted 506
9 SASI_Hs02_00470109 predicted 507
10 SASI_Hs02_00470110 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241275 predicted 639
2 SASI_Rn02_00241276 predicted 609
3 SASI_Rn02_00241277 predicted 288
4 SASI_Rn02_00241278 predicted 561
5 SASI_Rn02_00241279 predicted 309
6 SASI_Rn02_00241280 predicted 307
7 SASI_Rn02_00241281 predicted 552
8 SASI_Rn02_00241282 predicted 474
9 SASI_Rn02_00241283 predicted 549
10 SASI_Rn02_00241284 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424161 predicted 378
2 SASI_Mm01_00277955 predicted 403
3 SASI_Mm02_00424162 predicted 431
4 SASI_Mm01_00277956 predicted 417
5 SASI_Mm01_00277958 predicted 386
6 SASI_Mm01_00277959 predicted 432
7 SASI_Mm01_00277961 predicted 398
8 SASI_Mm01_00277962 predicted 415
9 SASI_Mm02_00424163 predicted 435
10 SASI_Mm02_00424164 predicted 402
11 SASI_Mm01_00277953 predicted 303
12 SASI_Mm01_00277954 predicted 449
13 SASI_Mm01_00277957 predicted 348
14 SASI_Mm01_00277960 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438233 predicted 294
2 SASI_Mm02_00438234 predicted 439
3 SASI_Mm02_00438235 predicted 411
4 SASI_Mm02_00438236 predicted 414
5 SASI_Mm02_00438237 predicted 388
6 SASI_Mm02_00438238 predicted 258
7 SASI_Mm02_00438239 predicted 427
8 SASI_Mm02_00438240 predicted 277
9 SASI_Mm02_00438241 predicted 402
10 SASI_Mm02_00438242 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029152
EFCAB10 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-474s21c1
Sequence:CCGGGGCAGAGGCTGCATATCATTTCTCGAGAAATGATATGCAGCCTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-299s21c1
Sequence:CCGGGGAATTGCTGAATCAACTTACCTCGAGGTAAGTTGATTCAGCAATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-444s21c1
Sequence:CCGGGTGTCCATGTTTGAGATGATGCTCGAGCATCATCTCAAACATGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-406s21c1
Sequence:CCGGACGTGGCATTTCCCTACTTTACTCGAGTAAAGTAGGGAAATGCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-497s21c1
Sequence:CCGGGCAGTATAAAGAAGCCCTAAACTCGAGTTTAGGGCTTCTTTATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029152
EFCAB10 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-474s21c1
Sequence:CCGGGGCAGAGGCTGCATATCATTTCTCGAGAAATGATATGCAGCCTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-299s21c1
Sequence:CCGGGGAATTGCTGAATCAACTTACCTCGAGGTAAGTTGATTCAGCAATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-444s21c1
Sequence:CCGGGTGTCCATGTTTGAGATGATGCTCGAGCATCATCTCAAACATGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-406s21c1
Sequence:CCGGACGTGGCATTTCCCTACTTTACTCGAGTAAAGTAGGGAAATGCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-497s21c1
Sequence:CCGGGCAGTATAAAGAAGCCCTAAACTCGAGTTTAGGGCTTCTTTATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029152
EFCAB10 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-474s21c1
Sequence:CCGGGGCAGAGGCTGCATATCATTTCTCGAGAAATGATATGCAGCCTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-299s21c1
Sequence:CCGGGGAATTGCTGAATCAACTTACCTCGAGGTAAGTTGATTCAGCAATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-444s21c1
Sequence:CCGGGTGTCCATGTTTGAGATGATGCTCGAGCATCATCTCAAACATGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-406s21c1
Sequence:CCGGACGTGGCATTTCCCTACTTTACTCGAGTAAAGTAGGGAAATGCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029152.1-497s21c1
Sequence:CCGGGCAGTATAAAGAAGCCCTAAACTCGAGTTTAGGGCTTCTTTATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)