EMAIL THIS PAGE TO A FRIEND

EFCAB11

EF-hand calcium binding domain 11

112 Gene Product Result for
Synonyms: C14orf143
UniProtKB ID: Q9BUY7, B3KT10, Q86T09, Q86TV7, Q8NDQ1
Gene ID:
Mouse(78767) EF-hand calcium binding domain 11
Rat(500705) EF-hand calcium binding domain 11
Zebrafish(550510) EF-hand calcium binding domain 11
domestic cat(101085384) EF-hand calcium binding domain 11
cow(617365) EF-hand calcium binding domain 11
dog(480414) EF-hand calcium binding domain 11
chicken(428903) EF-hand calcium binding domain 11
domestic guinea pig(100724388) EF-hand calcium binding domain 11
naked mole-rat(101715394) EF-hand calcium binding domain 11
sheep(101119643) EF-hand calcium binding domain 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145231 Rosetta Predictions human pricing
NM_001024350 Rosetta Predictions rat pricing
NM_030172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365067 predicted 450
2 SASI_Hs01_00039123 predicted 339
3 SASI_Hs01_00039124 predicted 380
4 SASI_Hs01_00039125 predicted 342
5 SASI_Hs01_00039127 predicted 462
6 SASI_Hs02_00365068 predicted 215
7 SASI_Hs02_00365069 predicted 234
8 SASI_Hs01_00039128 predicted 259
9 SASI_Hs02_00365070 predicted 374
10 SASI_Hs02_00365071 predicted 352
11 SASI_Hs01_00039121 predicted 232
12 SASI_Hs01_00039122 predicted 230
13 SASI_Hs01_00039126 predicted 945
14 SASI_Hs01_00039129 predicted 98
15 SASI_Hs01_00039130 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112579 predicted 644
2 SASI_Rn01_00112580 predicted 497
3 SASI_Rn01_00112581 predicted 650
4 SASI_Rn01_00112582 predicted 592
5 SASI_Rn01_00112583 predicted 633
6 SASI_Rn01_00112584 predicted 883
7 SASI_Rn01_00112585 predicted 930
8 SASI_Rn01_00112586 predicted 861
9 SASI_Rn01_00112587 predicted 340
10 SASI_Rn01_00112588 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145435 predicted 284
2 SASI_Mm01_00145438 predicted 648
3 SASI_Mm01_00145437 predicted 603
4 SASI_Mm02_00336581 predicted 660
5 SASI_Mm02_00336582 predicted 639
6 SASI_Mm01_00145439 predicted 202
7 SASI_Mm01_00145440 predicted 548
8 SASI_Mm01_00145441 predicted 368
9 SASI_Mm01_00145442 predicted 238
10 SASI_Mm01_00145443 predicted 420
11 SASI_Mm01_00145436 predicted 659
12 SASI_Mm01_00145444 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030172
EFCAB11 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-343s21c1
Sequence:CCGGAGAAGGAAGCGCGACTCTATCCTCGAGGATAGAGTCGCGCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-197s21c1
Sequence:CCGGCCTAAGCCGAGAGGACTTTAACTCGAGTTAAAGTCCTCTCGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-428s21c1
Sequence:CCGGAGATTTCAAGAGGGCGTTTAGCTCGAGCTAAACGCCCTCTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-396s21c1
Sequence:CCGGGACGTGCACTATCGTGGATTTCTCGAGAAATCCACGATAGTGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030172.2-1535s21c1
Sequence:CCGGACAAGCTTCATGCTCATATAACTCGAGTTATATGAGCATGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030172.1-1913s1c1
Sequence:CCGGGCAGAAATGAATTACTGGTATCTCGAGATACCAGTAATTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030172.1-498s1c1
Sequence:CCGGGAGGCAGATCAAGACTCAGATCTCGAGATCTGAGTCTTGATCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030172
EFCAB11 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-343s21c1
Sequence:CCGGAGAAGGAAGCGCGACTCTATCCTCGAGGATAGAGTCGCGCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-197s21c1
Sequence:CCGGCCTAAGCCGAGAGGACTTTAACTCGAGTTAAAGTCCTCTCGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-428s21c1
Sequence:CCGGAGATTTCAAGAGGGCGTTTAGCTCGAGCTAAACGCCCTCTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-396s21c1
Sequence:CCGGGACGTGCACTATCGTGGATTTCTCGAGAAATCCACGATAGTGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030172.2-1535s21c1
Sequence:CCGGACAAGCTTCATGCTCATATAACTCGAGTTATATGAGCATGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030172.1-1913s1c1
Sequence:CCGGGCAGAAATGAATTACTGGTATCTCGAGATACCAGTAATTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030172.1-498s1c1
Sequence:CCGGGAGGCAGATCAAGACTCAGATCTCGAGATCTGAGTCTTGATCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030172
EFCAB11 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-343s21c1
Sequence:CCGGAGAAGGAAGCGCGACTCTATCCTCGAGGATAGAGTCGCGCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-197s21c1
Sequence:CCGGCCTAAGCCGAGAGGACTTTAACTCGAGTTAAAGTCCTCTCGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-428s21c1
Sequence:CCGGAGATTTCAAGAGGGCGTTTAGCTCGAGCTAAACGCCCTCTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030172.2-396s21c1
Sequence:CCGGGACGTGCACTATCGTGGATTTCTCGAGAAATCCACGATAGTGCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030172.2-1535s21c1
Sequence:CCGGACAAGCTTCATGCTCATATAACTCGAGTTATATGAGCATGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030172.1-1913s1c1
Sequence:CCGGGCAGAAATGAATTACTGGTATCTCGAGATACCAGTAATTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030172.1-498s1c1
Sequence:CCGGGAGGCAGATCAAGACTCAGATCTCGAGATCTGAGTCTTGATCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145231
VALIDATED
EFCAB11 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-249s21c1
Sequence:CCGGCCTCCAAGATAGAAGTGGATTCTCGAGAATCCACTTCTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-176s21c1
Sequence:CCGGGATGAAGATCACAAAGGATATCTCGAGATATCCTTTGTGATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-147s21c1
Sequence:CCGGGGAAGTGGGTGGAAGTATTTACTCGAGTAAATACTTCCACCCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-364s21c1
Sequence:CCGGGAACGAAGTAAGACACATCTTCTCGAGAAGATGTGTCTTACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-493s21c1
Sequence:CCGGCAGGGAAGTAGATCGAGATTCCTCGAGGAATCTCGATCTACTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-193s1c1
Sequence:CCGGCCTCCAAGATAGAAGTGGATTCTCGAGAATCCACTTCTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-120s1c1
Sequence:CCGGGATGAAGATCACAAAGGATATCTCGAGATATCCTTTGTGATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-308s1c1
Sequence:CCGGGAACGAAGTAAGACACATCTTCTCGAGAAGATGTGTCTTACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-339s1c1
Sequence:CCGGGACACCTACTATCGTGGATTTCTCGAGAAATCCACGATAGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145231.1-482s1c1
Sequence:CCGGCTTTGAATATGCCCTGAACTACTCGAGTAGTTCAGGGCATATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145231
VALIDATED
EFCAB11 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-249s21c1
Sequence:CCGGCCTCCAAGATAGAAGTGGATTCTCGAGAATCCACTTCTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-176s21c1
Sequence:CCGGGATGAAGATCACAAAGGATATCTCGAGATATCCTTTGTGATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-147s21c1
Sequence:CCGGGGAAGTGGGTGGAAGTATTTACTCGAGTAAATACTTCCACCCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-364s21c1
Sequence:CCGGGAACGAAGTAAGACACATCTTCTCGAGAAGATGTGTCTTACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-493s21c1
Sequence:CCGGCAGGGAAGTAGATCGAGATTCCTCGAGGAATCTCGATCTACTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-193s1c1
Sequence:CCGGCCTCCAAGATAGAAGTGGATTCTCGAGAATCCACTTCTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-120s1c1
Sequence:CCGGGATGAAGATCACAAAGGATATCTCGAGATATCCTTTGTGATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-308s1c1
Sequence:CCGGGAACGAAGTAAGACACATCTTCTCGAGAAGATGTGTCTTACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-339s1c1
Sequence:CCGGGACACCTACTATCGTGGATTTCTCGAGAAATCCACGATAGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145231.1-482s1c1
Sequence:CCGGCTTTGAATATGCCCTGAACTACTCGAGTAGTTCAGGGCATATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145231
VALIDATED
EFCAB11 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-249s21c1
Sequence:CCGGCCTCCAAGATAGAAGTGGATTCTCGAGAATCCACTTCTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-176s21c1
Sequence:CCGGGATGAAGATCACAAAGGATATCTCGAGATATCCTTTGTGATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-147s21c1
Sequence:CCGGGGAAGTGGGTGGAAGTATTTACTCGAGTAAATACTTCCACCCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-364s21c1
Sequence:CCGGGAACGAAGTAAGACACATCTTCTCGAGAAGATGTGTCTTACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145231.2-493s21c1
Sequence:CCGGCAGGGAAGTAGATCGAGATTCCTCGAGGAATCTCGATCTACTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-193s1c1
Sequence:CCGGCCTCCAAGATAGAAGTGGATTCTCGAGAATCCACTTCTATCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-120s1c1
Sequence:CCGGGATGAAGATCACAAAGGATATCTCGAGATATCCTTTGTGATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-308s1c1
Sequence:CCGGGAACGAAGTAAGACACATCTTCTCGAGAAGATGTGTCTTACTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145231.1-339s1c1
Sequence:CCGGGACACCTACTATCGTGGATTTCTCGAGAAATCCACGATAGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145231.1-482s1c1
Sequence:CCGGCTTTGAATATGCCCTGAACTACTCGAGTAGTTCAGGGCATATTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks