EMAIL THIS PAGE TO A FRIEND

EFCAB12

EF-hand calcium binding domain 12

66 Gene Product Result for
Synonyms: C3orf25
UniProtKB ID: Q6NXP0, Q69YX4
Gene ID:
Mouse(212516) EF-hand calcium binding domain 12
Rat(680899) EF-hand calcium binding domain 12
sheep(101107051) EF-hand calcium binding domain 12
naked mole-rat(101724435) EF-hand calcium binding domain 12
domestic guinea pig(100715098) EF-hand calcium binding domain 12
cow(514973) EF-hand calcium binding domain 12
domestic cat(101097551) EF-hand calcium binding domain 12
dog(484645) EF-hand calcium binding domain 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_030669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_030669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_030669 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207307 Rosetta Predictions human pricing
XM_001059384 Rosetta Predictions rat pricing
NM_001110506 Rosetta Predictions mouse pricing
NM_198603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158294 predicted 1606
2 SASI_Hs01_00158295 predicted 218
3 SASI_Hs01_00158296 predicted 811
4 SASI_Hs01_00158297 predicted 798
5 SASI_Hs01_00158298 predicted 1836
6 SASI_Hs01_00158299 predicted 1478
7 SASI_Hs02_00373830 predicted 928
8 SASI_Hs01_00158300 predicted 1828
9 SASI_Hs01_00158301 predicted 1543
10 SASI_Hs01_00158302 predicted 1301
11 SASI_Hs01_00158303 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293026 predicted 1997
2 SASI_Rn02_00293027 predicted 2001
3 SASI_Rn02_00293028 predicted 1983
4 SASI_Rn02_00293029 predicted 1939
5 SASI_Rn02_00293030 predicted 1995
6 SASI_Rn02_00293031 predicted 1947
7 SASI_Rn02_00293032 predicted 1941
8 SASI_Rn02_00293033 predicted 2015
9 SASI_Rn02_00293034 predicted 2025
10 SASI_Rn02_00293035 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305598 predicted 2028
2 SASI_Mm02_00305599 predicted 1824
3 SASI_Mm02_00305600 predicted 1464
4 SASI_Mm02_00305601 predicted 326
5 SASI_Mm02_00305602 predicted 1678
6 SASI_Mm02_00305603 predicted 632
7 SASI_Mm02_00305604 predicted 631
8 SASI_Mm02_00305605 predicted 1464
9 SASI_Mm02_00305606 predicted 467
10 SASI_Mm02_00305607 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128937 predicted 333
2 SASI_Mm01_00128938 predicted 596
3 SASI_Mm01_00128939 predicted 1185
4 SASI_Mm01_00128940 predicted 470
5 SASI_Mm01_00128941 predicted 1092
6 SASI_Mm01_00128942 predicted 1256
7 SASI_Mm01_00128943 predicted 984
8 SASI_Mm01_00128944 predicted 654
9 SASI_Mm01_00128945 predicted 711
10 SASI_Mm01_00128946 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198603
EFCAB12 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 12
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-1168s1c1
Sequence:CCGGCCTTCGTAGTCGAAAGATCAACTCGAGTTGATCTTTCGACTACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-375s1c1
Sequence:CCGGGAGGGTACAAACAAACAAGAACTCGAGTTCTTGTTTGTTTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198603.1-2371s1c1
Sequence:CCGGCCATGCCTATTATGATGCAAACTCGAGTTTGCATCATAATAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-976s1c1
Sequence:CCGGGCTGGACAATAAGCCCAACATCTCGAGATGTTGGGCTTATTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-1063s1c1
Sequence:CCGGGATTTCAATCAGGAGAGCCAACTCGAGTTGGCTCTCCTGATTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198603.1-991s1c1
Sequence:CCGGCAACATCACATCATCAGAGTTCTCGAGAACTCTGATGATGTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198603
EFCAB12 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 12
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-1168s1c1
Sequence:CCGGCCTTCGTAGTCGAAAGATCAACTCGAGTTGATCTTTCGACTACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-375s1c1
Sequence:CCGGGAGGGTACAAACAAACAAGAACTCGAGTTCTTGTTTGTTTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198603.1-2371s1c1
Sequence:CCGGCCATGCCTATTATGATGCAAACTCGAGTTTGCATCATAATAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-976s1c1
Sequence:CCGGGCTGGACAATAAGCCCAACATCTCGAGATGTTGGGCTTATTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-1063s1c1
Sequence:CCGGGATTTCAATCAGGAGAGCCAACTCGAGTTGGCTCTCCTGATTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198603.1-991s1c1
Sequence:CCGGCAACATCACATCATCAGAGTTCTCGAGAACTCTGATGATGTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198603
EFCAB12 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 12
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-1168s1c1
Sequence:CCGGCCTTCGTAGTCGAAAGATCAACTCGAGTTGATCTTTCGACTACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-375s1c1
Sequence:CCGGGAGGGTACAAACAAACAAGAACTCGAGTTCTTGTTTGTTTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198603.1-2371s1c1
Sequence:CCGGCCATGCCTATTATGATGCAAACTCGAGTTTGCATCATAATAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-976s1c1
Sequence:CCGGGCTGGACAATAAGCCCAACATCTCGAGATGTTGGGCTTATTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198603.1-1063s1c1
Sequence:CCGGGATTTCAATCAGGAGAGCCAACTCGAGTTGGCTCTCCTGATTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198603.1-991s1c1
Sequence:CCGGCAACATCACATCATCAGAGTTCTCGAGAACTCTGATGATGTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_030669
EFCAB12 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 12
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000130639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_030669.9-987s1c1
Sequence:CCGGCCACTGCAAGGGAGCATTATACTCGAGTATAATGCTCCCTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_030669.9-1951s1c1
Sequence:CCGGCAGACACAAGAGGAGTGTCAACTCGAGTTGACACTCCTCTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030669.9-1816s1c1
Sequence:CCGGCCTTAGGAACAAGAACTACATCTCGAGATGTAGTTCTTGTTCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_030669
EFCAB12 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 12
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000130639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_030669.9-987s1c1
Sequence:CCGGCCACTGCAAGGGAGCATTATACTCGAGTATAATGCTCCCTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_030669.9-1951s1c1
Sequence:CCGGCAGACACAAGAGGAGTGTCAACTCGAGTTGACACTCCTCTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030669.9-1816s1c1
Sequence:CCGGCCTTAGGAACAAGAACTACATCTCGAGATGTAGTTCTTGTTCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_030669
EFCAB12 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 12
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000130639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_030669.9-987s1c1
Sequence:CCGGCCACTGCAAGGGAGCATTATACTCGAGTATAATGCTCCCTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_030669.9-1951s1c1
Sequence:CCGGCAGACACAAGAGGAGTGTCAACTCGAGTTGACACTCCTCTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_030669.9-1816s1c1
Sequence:CCGGCCTTAGGAACAAGAACTACATCTCGAGATGTAGTTCTTGTTCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207307
EFCAB12 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1963s1c1
Sequence:CCGGGAGTGTCAAAGAGTCAAACTACTCGAGTAGTTTGACTCTTTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1986s1c1
Sequence:CCGGGAAATCCTTTCAAAGAGGGATCTCGAGATCCCTCTTTGAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1960s1c1
Sequence:CCGGGAGGAGTGTCAAAGAGTCAAACTCGAGTTTGACTCTTTGACACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-820s21c1
Sequence:CCGGGGAGTTCATCGCGGCTGTAAACTCGAGTTTACAGCCGCGATGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-1422s21c1
Sequence:CCGGACCCAGGAGACAAGATCATTTCTCGAGAAATGATCTTGTCTCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-986s21c1
Sequence:CCGGGCCACTGCAAGGGAGCATTATCTCGAGATAATGCTCCCTTGCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-1600s21c1
Sequence:CCGGTAAGGAGTTTGAGGAATTTACCTCGAGGTAAATTCCTCAAACTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207307
EFCAB12 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1963s1c1
Sequence:CCGGGAGTGTCAAAGAGTCAAACTACTCGAGTAGTTTGACTCTTTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1986s1c1
Sequence:CCGGGAAATCCTTTCAAAGAGGGATCTCGAGATCCCTCTTTGAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1960s1c1
Sequence:CCGGGAGGAGTGTCAAAGAGTCAAACTCGAGTTTGACTCTTTGACACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-820s21c1
Sequence:CCGGGGAGTTCATCGCGGCTGTAAACTCGAGTTTACAGCCGCGATGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-1422s21c1
Sequence:CCGGACCCAGGAGACAAGATCATTTCTCGAGAAATGATCTTGTCTCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-986s21c1
Sequence:CCGGGCCACTGCAAGGGAGCATTATCTCGAGATAATGCTCCCTTGCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-1600s21c1
Sequence:CCGGTAAGGAGTTTGAGGAATTTACCTCGAGGTAAATTCCTCAAACTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207307
EFCAB12 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1963s1c1
Sequence:CCGGGAGTGTCAAAGAGTCAAACTACTCGAGTAGTTTGACTCTTTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1986s1c1
Sequence:CCGGGAAATCCTTTCAAAGAGGGATCTCGAGATCCCTCTTTGAAAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207307.1-1960s1c1
Sequence:CCGGGAGGAGTGTCAAAGAGTCAAACTCGAGTTTGACTCTTTGACACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-820s21c1
Sequence:CCGGGGAGTTCATCGCGGCTGTAAACTCGAGTTTACAGCCGCGATGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-1422s21c1
Sequence:CCGGACCCAGGAGACAAGATCATTTCTCGAGAAATGATCTTGTCTCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-986s21c1
Sequence:CCGGGCCACTGCAAGGGAGCATTATCTCGAGATAATGCTCCCTTGCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207307.1-1600s21c1
Sequence:CCGGTAAGGAGTTTGAGGAATTTACCTCGAGGTAAATTCCTCAAACTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks