EMAIL THIS PAGE TO A FRIEND

EFCAB14

EF-hand calcium binding domain 14

162 Gene Product Result for
Synonyms: KIAA0494 RP11-8J9.3
UniProtKB ID: O75071, D3DQ23, Q5SXB8
Gene ID:
Mouse(230648) EF-hand calcium binding domain 14
Rat(298425) EF-hand calcium binding domain 14
domestic guinea pig(100730137) EF-hand calcium binding domain 14
naked mole-rat(101724916) EF-hand calcium binding domain 14
dog(482507) EF-hand calcium binding domain 14
cow(512180) EF-hand calcium binding domain 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106757 Anti-Efcab14 antibody produced in rabbit affinity isolated antibody horse, human, rabbit, mouse, guinea pig
ELISA, western blot pricing
HPA011224 Anti-EFCAB14 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA011938 Anti-EFCAB14 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV47075 Anti-KIAA0494 antibody produced in rabbit IgG fraction of antiserum horse, rat, rabbit, bovine, human, mouse, canine, guinea pig
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_375726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014774 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132001 MISSION® esiRNA esiRNA human KIAA0494 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014774 Rosetta Predictions human pricing
NM_001106677 Rosetta Predictions rat pricing
NM_172698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081184 predicted 1114
2 SASI_Hs01_00081185 predicted 1641
3 SASI_Hs02_00346266 predicted 1989
4 SASI_Hs01_00081187 predicted 2099
5 SASI_Hs01_00081188 predicted 2011
6 SASI_Hs01_00081190 predicted 2448
7 SASI_Hs01_00081191 predicted 1944
8 SASI_Hs01_00081192 predicted 1659
9 SASI_Hs01_00081193 predicted 2426
10 SASI_Hs02_00346267 predicted 1454
11 SASI_Hs01_00081186 predicted 1361
12 SASI_Hs01_00081189 predicted 2169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221298 predicted 1446
2 SASI_Rn02_00221299 predicted 2056
3 SASI_Rn02_00221300 predicted 1984
4 SASI_Rn02_00221301 predicted 1547
5 SASI_Rn02_00221302 predicted 1290
6 SASI_Rn02_00221303 predicted 1107
7 SASI_Rn02_00221304 predicted 1485
8 SASI_Rn02_00221305 predicted 1861
9 SASI_Rn02_00221306 predicted 1552
10 SASI_Rn02_00221307 predicted 2201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134561 predicted 1069
2 SASI_Mm01_00134562 predicted 1320
3 SASI_Mm01_00134564 predicted 594
4 SASI_Mm01_00134565 predicted 1808
5 SASI_Mm02_00344448 predicted 1759
6 SASI_Mm01_00134566 predicted 1100
7 SASI_Mm01_00134567 predicted 1398
8 SASI_Mm01_00134568 predicted 720
9 SASI_Mm01_00134569 predicted 1052
10 SASI_Mm02_00344449 predicted 2252
11 SASI_Mm01_00134563 predicted 954
12 SASI_Mm01_00134570 predicted 1868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375726
VALIDATED
EFCAB14 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-492s1c1
Sequence:CCGGCCCAAACTTAATGAAGAACTACTCGAGTAGTTCTTCATTAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-1530s1c1
Sequence:CCGGCCAGAGAGCTTGAGAGCATTTCTCGAGAAATGCTCTCAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-1426s1c1
Sequence:CCGGGCACTGAAGATCTTCAGGATTCTCGAGAATCCTGAAGATCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-298s1c1
Sequence:CCGGGCTTTGCCAAGGGAGACTATTCTCGAGAATAGTCTCCCTTGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-871s1c1
Sequence:CCGGCCACATCAGAACTTGACAATACTCGAGTATTGTCAAGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375726
VALIDATED
EFCAB14 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-492s1c1
Sequence:CCGGCCCAAACTTAATGAAGAACTACTCGAGTAGTTCTTCATTAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-1530s1c1
Sequence:CCGGCCAGAGAGCTTGAGAGCATTTCTCGAGAAATGCTCTCAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-1426s1c1
Sequence:CCGGGCACTGAAGATCTTCAGGATTCTCGAGAATCCTGAAGATCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-298s1c1
Sequence:CCGGGCTTTGCCAAGGGAGACTATTCTCGAGAATAGTCTCCCTTGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-871s1c1
Sequence:CCGGCCACATCAGAACTTGACAATACTCGAGTATTGTCAAGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375726
VALIDATED
EFCAB14 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-492s1c1
Sequence:CCGGCCCAAACTTAATGAAGAACTACTCGAGTAGTTCTTCATTAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-1530s1c1
Sequence:CCGGCCAGAGAGCTTGAGAGCATTTCTCGAGAAATGCTCTCAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-1426s1c1
Sequence:CCGGGCACTGAAGATCTTCAGGATTCTCGAGAATCCTGAAGATCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-298s1c1
Sequence:CCGGGCTTTGCCAAGGGAGACTATTCTCGAGAATAGTCTCCCTTGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_375726.1-871s1c1
Sequence:CCGGCCACATCAGAACTTGACAATACTCGAGTATTGTCAAGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172698
VALIDATED
EFCAB14 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-1313s1c1
Sequence:CCGGCCTCCATCAGAGCTTGACAATCTCGAGATTGTCAAGCTCTGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-634s1c1
Sequence:CCGGCCATCGGAGAAAGAAGACCAACTCGAGTTGGTCTTCTTTCTCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-1861s1c1
Sequence:CCGGCAAAGATCTTCAGGATTTATTCTCGAGAATAAATCCTGAAGATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-2012s1c1
Sequence:CCGGCTGGAACTAAGATTAGCTTTACTCGAGTAAAGCTAATCTTAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172698.2-2012s21c1
Sequence:CCGGCTGGAACTAAGATTAGCTTTACTCGAGTAAAGCTAATCTTAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1315s21c1
Sequence:CCGGTCCATCAGAGCTTGACAATAACTCGAGTTATTGTCAAGCTCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1111s21c1
Sequence:CCGGGTCAGCCGCAGACTTACTTAGCTCGAGCTAAGTAAGTCTGCGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1860s21c1
Sequence:CCGGTCAAAGATCTTCAGGATTTATCTCGAGATAAATCCTGAAGATCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-3769s21c1
Sequence:CCGGGCTCTTAAGAATGGGTCTAATCTCGAGATTAGACCCATTCTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172698
VALIDATED
EFCAB14 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-1313s1c1
Sequence:CCGGCCTCCATCAGAGCTTGACAATCTCGAGATTGTCAAGCTCTGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-634s1c1
Sequence:CCGGCCATCGGAGAAAGAAGACCAACTCGAGTTGGTCTTCTTTCTCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-1861s1c1
Sequence:CCGGCAAAGATCTTCAGGATTTATTCTCGAGAATAAATCCTGAAGATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-2012s1c1
Sequence:CCGGCTGGAACTAAGATTAGCTTTACTCGAGTAAAGCTAATCTTAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172698.2-2012s21c1
Sequence:CCGGCTGGAACTAAGATTAGCTTTACTCGAGTAAAGCTAATCTTAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1315s21c1
Sequence:CCGGTCCATCAGAGCTTGACAATAACTCGAGTTATTGTCAAGCTCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1111s21c1
Sequence:CCGGGTCAGCCGCAGACTTACTTAGCTCGAGCTAAGTAAGTCTGCGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1860s21c1
Sequence:CCGGTCAAAGATCTTCAGGATTTATCTCGAGATAAATCCTGAAGATCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-3769s21c1
Sequence:CCGGGCTCTTAAGAATGGGTCTAATCTCGAGATTAGACCCATTCTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172698
VALIDATED
EFCAB14 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-1313s1c1
Sequence:CCGGCCTCCATCAGAGCTTGACAATCTCGAGATTGTCAAGCTCTGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-634s1c1
Sequence:CCGGCCATCGGAGAAAGAAGACCAACTCGAGTTGGTCTTCTTTCTCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-1861s1c1
Sequence:CCGGCAAAGATCTTCAGGATTTATTCTCGAGAATAAATCCTGAAGATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172698.2-2012s1c1
Sequence:CCGGCTGGAACTAAGATTAGCTTTACTCGAGTAAAGCTAATCTTAGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172698.2-2012s21c1
Sequence:CCGGCTGGAACTAAGATTAGCTTTACTCGAGTAAAGCTAATCTTAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1315s21c1
Sequence:CCGGTCCATCAGAGCTTGACAATAACTCGAGTTATTGTCAAGCTCTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1111s21c1
Sequence:CCGGGTCAGCCGCAGACTTACTTAGCTCGAGCTAAGTAAGTCTGCGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-1860s21c1
Sequence:CCGGTCAAAGATCTTCAGGATTTATCTCGAGATAAATCCTGAAGATCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172698.2-3769s21c1
Sequence:CCGGGCTCTTAAGAATGGGTCTAATCTCGAGATTAGACCCATTCTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014774
VALIDATED
EFCAB14 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2593s21c1
Sequence:CCGGCTTGTTTGAAGAAGCTATATACTCGAGTATATAGCTTCTTCAAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2281s21c1
Sequence:CCGGGCACTGAAGATCTTCAGGATTCTCGAGAATCCTGAAGATCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2385s21c1
Sequence:CCGGCCAGAGAGCTTGAGAGCATTTCTCGAGAAATGCTCTCAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-1726s21c1
Sequence:CCGGCCACATCAGAACTTGACAATACTCGAGTATTGTCAAGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014774.2-2462s21c1
Sequence:CCGGCTAGCTTCATCAGGCATATTTCTCGAGAAATATGCCTGATGAAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014774
VALIDATED
EFCAB14 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2593s21c1
Sequence:CCGGCTTGTTTGAAGAAGCTATATACTCGAGTATATAGCTTCTTCAAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2281s21c1
Sequence:CCGGGCACTGAAGATCTTCAGGATTCTCGAGAATCCTGAAGATCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2385s21c1
Sequence:CCGGCCAGAGAGCTTGAGAGCATTTCTCGAGAAATGCTCTCAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-1726s21c1
Sequence:CCGGCCACATCAGAACTTGACAATACTCGAGTATTGTCAAGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014774.2-2462s21c1
Sequence:CCGGCTAGCTTCATCAGGCATATTTCTCGAGAAATATGCCTGATGAAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014774
VALIDATED
EFCAB14 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2593s21c1
Sequence:CCGGCTTGTTTGAAGAAGCTATATACTCGAGTATATAGCTTCTTCAAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2281s21c1
Sequence:CCGGGCACTGAAGATCTTCAGGATTCTCGAGAATCCTGAAGATCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-2385s21c1
Sequence:CCGGCCAGAGAGCTTGAGAGCATTTCTCGAGAAATGCTCTCAAGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014774.2-1726s21c1
Sequence:CCGGCCACATCAGAACTTGACAATACTCGAGTATTGTCAAGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014774.2-2462s21c1
Sequence:CCGGCTAGCTTCATCAGGCATATTTCTCGAGAAATATGCCTGATGAAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks