EMAIL THIS PAGE TO A FRIEND

EFCAB1

EF-hand calcium binding domain 1

60 Gene Product Result for
UniProtKB ID: Q9HAE3, B4DSB4, E7EVN7
Gene ID:
Mouse(66793) EF hand calcium binding domain 1
Rat(301957) EF hand calcium binding domain 1
Zebrafish(558421) EF-hand calcium binding domain 1
domestic cat(101090588) EF-hand calcium binding domain 1
cow(505272) EF-hand calcium binding domain 1
dog(477872) EF-hand calcium binding domain 1
chicken(420556) EF-hand calcium binding domain 1
domestic guinea pig(100720951) EF-hand calcium binding domain 1
naked mole-rat(101717799) EF-hand calcium binding domain 1
sheep(101111889) EF-hand calcium binding domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024593 Rosetta Predictions human pricing
NM_001106930 Rosetta Predictions rat pricing
NM_025769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109482 predicted 514
2 SASI_Hs01_00109483 predicted 213
3 SASI_Hs01_00109485 predicted 708
4 SASI_Hs01_00109487 predicted 254
5 SASI_Hs01_00109488 predicted 528
6 SASI_Hs01_00109489 predicted 582
7 SASI_Hs01_00109490 predicted 696
8 SASI_Hs01_00109491 predicted 597
9 SASI_Hs02_00356929 predicted 273
10 SASI_Hs02_00356930 predicted 665
11 SASI_Hs01_00109484 predicted 312
12 SASI_Hs01_00109486 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223806 predicted 361
2 SASI_Rn02_00223807 predicted 826
3 SASI_Rn02_00223808 predicted 493
4 SASI_Rn02_00223809 predicted 734
5 SASI_Rn02_00223810 predicted 318
6 SASI_Rn02_00223811 predicted 626
7 SASI_Rn02_00223812 predicted 822
8 SASI_Rn02_00223813 predicted 755
9 SASI_Rn02_00223814 predicted 256
10 SASI_Rn02_00223815 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160862 predicted 368
2 SASI_Mm01_00160863 predicted 302
3 SASI_Mm01_00160864 predicted 557
4 SASI_Mm01_00160865 predicted 749
5 SASI_Mm01_00160866 predicted 351
6 SASI_Mm01_00160867 predicted 248
7 SASI_Mm01_00160868 predicted 474
8 SASI_Mm01_00160869 predicted 286
9 SASI_Mm01_00160870 predicted 714
10 SASI_Mm02_00328965 predicted 727
11 SASI_Mm01_00160871 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024593
EFCAB1 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-249s1c1
Sequence:CCGGCCTGCATGTGACATTTGGAATCTCGAGATTCCAAATGTCACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-665s1c1
Sequence:CCGGTGGAATTTGAAGCTCAAGTATCTCGAGATACTTGAGCTTCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-432s1c1
Sequence:CCGGCGGATTCATTTCAAAGGAGGACTCGAGTCCTCCTTTGAAATGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-214s1c1
Sequence:CCGGGTTGTTGGACTGGATCGTAATCTCGAGATTACGATCCAGTCCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-326s1c1
Sequence:CCGGGCTGTGTAAATGTATTGGAGTCTCGAGACTCCAATACATTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024593.3-940s21c1
Sequence:CCGGATCAGTGTAAGATGCAATTAACTCGAGTTAATTGCATCTTACACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024593.3-910s21c1
Sequence:CCGGGATGAGGTTCACTTACATATACTCGAGTATATGTAAGTGAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024593.3-443s21c1
Sequence:CCGGCTGTTTCTTCGAGGATCTTTGCTCGAGCAAAGATCCTCGAAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024593
EFCAB1 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-249s1c1
Sequence:CCGGCCTGCATGTGACATTTGGAATCTCGAGATTCCAAATGTCACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-665s1c1
Sequence:CCGGTGGAATTTGAAGCTCAAGTATCTCGAGATACTTGAGCTTCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-432s1c1
Sequence:CCGGCGGATTCATTTCAAAGGAGGACTCGAGTCCTCCTTTGAAATGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-214s1c1
Sequence:CCGGGTTGTTGGACTGGATCGTAATCTCGAGATTACGATCCAGTCCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-326s1c1
Sequence:CCGGGCTGTGTAAATGTATTGGAGTCTCGAGACTCCAATACATTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024593.3-940s21c1
Sequence:CCGGATCAGTGTAAGATGCAATTAACTCGAGTTAATTGCATCTTACACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024593.3-910s21c1
Sequence:CCGGGATGAGGTTCACTTACATATACTCGAGTATATGTAAGTGAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024593.3-443s21c1
Sequence:CCGGCTGTTTCTTCGAGGATCTTTGCTCGAGCAAAGATCCTCGAAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024593
EFCAB1 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-249s1c1
Sequence:CCGGCCTGCATGTGACATTTGGAATCTCGAGATTCCAAATGTCACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-665s1c1
Sequence:CCGGTGGAATTTGAAGCTCAAGTATCTCGAGATACTTGAGCTTCAAATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-432s1c1
Sequence:CCGGCGGATTCATTTCAAAGGAGGACTCGAGTCCTCCTTTGAAATGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-214s1c1
Sequence:CCGGGTTGTTGGACTGGATCGTAATCTCGAGATTACGATCCAGTCCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024593.2-326s1c1
Sequence:CCGGGCTGTGTAAATGTATTGGAGTCTCGAGACTCCAATACATTTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024593.3-940s21c1
Sequence:CCGGATCAGTGTAAGATGCAATTAACTCGAGTTAATTGCATCTTACACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024593.3-910s21c1
Sequence:CCGGGATGAGGTTCACTTACATATACTCGAGTATATGTAAGTGAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024593.3-443s21c1
Sequence:CCGGCTGTTTCTTCGAGGATCTTTGCTCGAGCAAAGATCCTCGAAGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025769
EFCAB1 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025769.1-838s1c1
Sequence:CCGGGCAGTTCACTTGTATGTATTTCTCGAGAAATACATACAAGTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-437s1c1
Sequence:CCGGCTTTGAAGTGTTTGATCTGAACTCGAGTTCAGATCAAACACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-309s1c1
Sequence:CCGGGACATGATTATGGACAGAGTACTCGAGTACTCTGTCCATAATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-543s1c1
Sequence:CCGGGAAGGGATTAAAGATTTGGTTCTCGAGAACCAAATCTTTAATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025769
EFCAB1 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025769.1-838s1c1
Sequence:CCGGGCAGTTCACTTGTATGTATTTCTCGAGAAATACATACAAGTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-437s1c1
Sequence:CCGGCTTTGAAGTGTTTGATCTGAACTCGAGTTCAGATCAAACACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-309s1c1
Sequence:CCGGGACATGATTATGGACAGAGTACTCGAGTACTCTGTCCATAATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-543s1c1
Sequence:CCGGGAAGGGATTAAAGATTTGGTTCTCGAGAACCAAATCTTTAATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025769
EFCAB1 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025769.1-838s1c1
Sequence:CCGGGCAGTTCACTTGTATGTATTTCTCGAGAAATACATACAAGTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-437s1c1
Sequence:CCGGCTTTGAAGTGTTTGATCTGAACTCGAGTTCAGATCAAACACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-309s1c1
Sequence:CCGGGACATGATTATGGACAGAGTACTCGAGTACTCTGTCCATAATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025769.1-543s1c1
Sequence:CCGGGAAGGGATTAAAGATTTGGTTCTCGAGAACCAAATCTTTAATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks