EMAIL THIS PAGE TO A FRIEND

EFCAB2

EF-hand calcium binding domain 2

UniProtKB ID: Q5VUJ9, B4DZE9, Q59G23, Q9BS36
Gene ID:
Mouse(68226) EF-hand calcium binding domain 2
Rat(289280) EF-hand calcium binding domain 2
Zebrafish(558031) EF-hand calcium binding domain 2
chicken(421491) EF-hand calcium binding domain 2
cow(615715) EF-hand calcium binding domain 2
domestic cat(101091334) EF-hand calcium binding domain 2
dog(611783) EF-hand calcium binding domain 2
naked mole-rat(101724451) EF-hand calcium binding domain 2
domestic guinea pig(100726675) EF-hand calcium binding domain 2
sheep(101106863) EF-hand calcium binding domain 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032328 Rosetta Predictions human pricing
NM_001105977 Rosetta Predictions rat pricing
NM_026626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079945 predicted 231
2 SASI_Hs01_00079946 predicted 440
3 SASI_Hs01_00079947 predicted 208
4 SASI_Hs01_00079948 predicted 346
5 SASI_Hs01_00079949 predicted 585
6 SASI_Hs01_00079950 predicted 363
7 SASI_Hs01_00079951 predicted 680
8 SASI_Hs01_00079952 predicted 554
9 SASI_Hs02_00359699 predicted 267
10 SASI_Hs01_00079953 predicted 489
11 SASI_Hs01_00079944 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214412 predicted 567
2 SASI_Rn02_00214413 predicted 296
3 SASI_Rn02_00214414 predicted 579
4 SASI_Rn02_00214415 predicted 310
5 SASI_Rn02_00214416 predicted 935
6 SASI_Rn02_00214417 predicted 252
7 SASI_Rn02_00214418 predicted 486
8 SASI_Rn02_00214419 predicted 602
9 SASI_Rn02_00214420 predicted 795
10 SASI_Rn02_00214421 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067487 predicted 333
2 SASI_Mm01_00067488 predicted 307
3 SASI_Mm01_00067489 predicted 652
4 SASI_Mm01_00067490 predicted 291
5 SASI_Mm01_00067491 predicted 661
6 SASI_Mm01_00067492 predicted 642
7 SASI_Mm01_00067493 predicted 249
8 SASI_Mm01_00067494 predicted 798
9 SASI_Mm01_00067495 predicted 544
10 SASI_Mm01_00067496 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032328
EFCAB2 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032328.3-1087s21c1
Sequence:CCGGTTGGCATGTAAAGATCTTAAGCTCGAGCTTAAGATCTTTACATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032328.3-854s21c1
Sequence:CCGGATACCTTGTGACATAACTATTCTCGAGAATAGTTATGTCACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-114s1c1
Sequence:CCGGGAGTCGAATAATACAGTGGATCTCGAGATCCACTGTATTATTCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-258s1c1
Sequence:CCGGCTTCCGGTGATGACAGAAATACTCGAGTATTTCTGTCATCACCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-342s1c1
Sequence:CCGGGATTCAGCTAAACGTGGGTTTCTCGAGAAACCCACGTTTAGCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-445s1c1
Sequence:CCGGCTGCAATTGATCCAGAATCAACTCGAGTTGATTCTGGATCAATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-146s1c1
Sequence:CCGGTGGAACAATTATCAGGTCATTCTCGAGAATGACCTGATAATTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032328
EFCAB2 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032328.3-1087s21c1
Sequence:CCGGTTGGCATGTAAAGATCTTAAGCTCGAGCTTAAGATCTTTACATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032328.3-854s21c1
Sequence:CCGGATACCTTGTGACATAACTATTCTCGAGAATAGTTATGTCACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-114s1c1
Sequence:CCGGGAGTCGAATAATACAGTGGATCTCGAGATCCACTGTATTATTCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-258s1c1
Sequence:CCGGCTTCCGGTGATGACAGAAATACTCGAGTATTTCTGTCATCACCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-342s1c1
Sequence:CCGGGATTCAGCTAAACGTGGGTTTCTCGAGAAACCCACGTTTAGCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-445s1c1
Sequence:CCGGCTGCAATTGATCCAGAATCAACTCGAGTTGATTCTGGATCAATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-146s1c1
Sequence:CCGGTGGAACAATTATCAGGTCATTCTCGAGAATGACCTGATAATTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032328
EFCAB2 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032328.3-1087s21c1
Sequence:CCGGTTGGCATGTAAAGATCTTAAGCTCGAGCTTAAGATCTTTACATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032328.3-854s21c1
Sequence:CCGGATACCTTGTGACATAACTATTCTCGAGAATAGTTATGTCACAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-114s1c1
Sequence:CCGGGAGTCGAATAATACAGTGGATCTCGAGATCCACTGTATTATTCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-258s1c1
Sequence:CCGGCTTCCGGTGATGACAGAAATACTCGAGTATTTCTGTCATCACCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-342s1c1
Sequence:CCGGGATTCAGCTAAACGTGGGTTTCTCGAGAAACCCACGTTTAGCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-445s1c1
Sequence:CCGGCTGCAATTGATCCAGAATCAACTCGAGTTGATTCTGGATCAATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032328.1-146s1c1
Sequence:CCGGTGGAACAATTATCAGGTCATTCTCGAGAATGACCTGATAATTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026626
VALIDATED
EFCAB2 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-279s1c1
Sequence:CCGGGAAGATCAAAGACGCATTTGACTCGAGTCAAATGCGTCTTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-631s1c1
Sequence:CCGGGAAATGTTGTCTGCTGCAATTCTCGAGAATTGCAGCAGACAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026626.2-2060s1c1
Sequence:CCGGCGCAAGAATCTGGGATTGAAACTCGAGTTTCAATCCCAGATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-393s1c1
Sequence:CCGGGCATGATTTCATTGCAGAGATCTCGAGATCTCTGCAATGAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026626.2-334s1c1
Sequence:CCGGGTGAGAGAGATTGGGACAATTCTCGAGAATTGTCCCAATCTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026626.2-2141s1c1
Sequence:CCGGCCTAAGAGATAATGAGCTAATCTCGAGATTAGCTCATTATCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026626.2-1444s1c1
Sequence:CCGGGCGTGTATTCATCTGTTGTTACTCGAGTAACAACAGATGAATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026626.2-655s1c1
Sequence:CCGGCCCGAATCAAACACCATTAATCTCGAGATTAATGGTGTTTGATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026626.2-253s1c1
Sequence:CCGGGAGGCACTAATTGCAGAACTTCTCGAGAAGTTCTGCAATTAGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026626
VALIDATED
EFCAB2 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-279s1c1
Sequence:CCGGGAAGATCAAAGACGCATTTGACTCGAGTCAAATGCGTCTTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-631s1c1
Sequence:CCGGGAAATGTTGTCTGCTGCAATTCTCGAGAATTGCAGCAGACAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026626.2-2060s1c1
Sequence:CCGGCGCAAGAATCTGGGATTGAAACTCGAGTTTCAATCCCAGATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-393s1c1
Sequence:CCGGGCATGATTTCATTGCAGAGATCTCGAGATCTCTGCAATGAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026626.2-334s1c1
Sequence:CCGGGTGAGAGAGATTGGGACAATTCTCGAGAATTGTCCCAATCTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026626.2-2141s1c1
Sequence:CCGGCCTAAGAGATAATGAGCTAATCTCGAGATTAGCTCATTATCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026626.2-1444s1c1
Sequence:CCGGGCGTGTATTCATCTGTTGTTACTCGAGTAACAACAGATGAATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026626.2-655s1c1
Sequence:CCGGCCCGAATCAAACACCATTAATCTCGAGATTAATGGTGTTTGATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026626.2-253s1c1
Sequence:CCGGGAGGCACTAATTGCAGAACTTCTCGAGAAGTTCTGCAATTAGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026626
VALIDATED
EFCAB2 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-279s1c1
Sequence:CCGGGAAGATCAAAGACGCATTTGACTCGAGTCAAATGCGTCTTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-631s1c1
Sequence:CCGGGAAATGTTGTCTGCTGCAATTCTCGAGAATTGCAGCAGACAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026626.2-2060s1c1
Sequence:CCGGCGCAAGAATCTGGGATTGAAACTCGAGTTTCAATCCCAGATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026626.2-393s1c1
Sequence:CCGGGCATGATTTCATTGCAGAGATCTCGAGATCTCTGCAATGAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026626.2-334s1c1
Sequence:CCGGGTGAGAGAGATTGGGACAATTCTCGAGAATTGTCCCAATCTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026626.2-2141s1c1
Sequence:CCGGCCTAAGAGATAATGAGCTAATCTCGAGATTAGCTCATTATCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026626.2-1444s1c1
Sequence:CCGGGCGTGTATTCATCTGTTGTTACTCGAGTAACAACAGATGAATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026626.2-655s1c1
Sequence:CCGGCCCGAATCAAACACCATTAATCTCGAGATTAATGGTGTTTGATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026626.2-253s1c1
Sequence:CCGGGAGGCACTAATTGCAGAACTTCTCGAGAAGTTCTGCAATTAGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks