EMAIL THIS PAGE TO A FRIEND

EFCAB3

EF-hand calcium binding domain 3

77 Gene Product Result for
UniProtKB ID: Q8N7B9, J3KQM8
Gene ID:
Mouse(70894) EF-hand calcium binding domain 3
Rat(303589) EF-hand calcium binding domain 3
domestic guinea pig(100714652) EF-hand calcium binding domain 3
naked mole-rat(101700545) EF-hand calcium binding domain 3
chicken(419947) EF-hand calcium binding domain 3
cow(524320) EF-hand calcium binding domain 3
domestic cat(101092905) EF-hand calcium binding domain 3
dog(490916) EF-hand calcium binding domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173503 Rosetta Predictions human pricing
NM_001013972 Rosetta Predictions rat pricing
NM_001081046 Rosetta Predictions mouse pricing
XM_109772 Rosetta Predictions mouse pricing
XM_903098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018025 predicted 396
2 SASI_Hs02_00368272 predicted 987
3 SASI_Hs01_00018027 predicted 994
4 SASI_Hs01_00018028 predicted 637
5 SASI_Hs02_00368273 predicted 314
6 SASI_Hs01_00018029 predicted 287
7 SASI_Hs01_00018030 predicted 599
8 SASI_Hs01_00018031 predicted 1242
9 SASI_Hs01_00018033 predicted 1051
10 SASI_Hs02_00368274 predicted 758
11 SASI_Hs01_00018024 predicted 1076
12 SASI_Hs01_00018026 predicted 976
13 SASI_Hs01_00018032 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201300 predicted 718
2 SASI_Rn02_00201301 predicted 686
3 SASI_Rn02_00201302 predicted 864
4 SASI_Rn02_00201303 predicted 1221
5 SASI_Rn02_00201304 predicted 705
6 SASI_Rn02_00201305 predicted 502
7 SASI_Rn02_00201306 predicted 982
8 SASI_Rn02_00201307 predicted 610
9 SASI_Rn02_00201308 predicted 772
10 SASI_Rn02_00201309 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294641 predicted 591
2 SASI_Mm02_00294642 predicted 469
3 SASI_Mm02_00294643 predicted 755
4 SASI_Mm02_00294644 predicted 436
5 SASI_Mm02_00294645 predicted 1257
6 SASI_Mm02_00294646 predicted 449
7 SASI_Mm02_00294647 predicted 485
8 SASI_Mm02_00294648 predicted 307
9 SASI_Mm02_00294649 predicted 1199
10 SASI_Mm02_00294650 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276036 predicted 601
2 SASI_Mm01_00276037 predicted 476
3 SASI_Mm01_00276038 predicted 770
4 SASI_Mm01_00276039 predicted 442
5 SASI_Mm01_00276040 predicted 1262
6 SASI_Mm01_00276041 predicted 913
7 SASI_Mm01_00276042 predicted 487
8 SASI_Mm01_00276043 predicted 310
9 SASI_Mm01_00276044 predicted 970
10 SASI_Mm01_00276045 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244469 predicted 1076
2 SASI_Mm01_00244470 predicted 997
3 SASI_Mm01_00244471 predicted 977
4 SASI_Mm01_00244472 predicted 1079
5 SASI_Mm01_00244473 predicted 982
6 SASI_Mm01_00244474 predicted 1033
7 SASI_Mm01_00244475 predicted 1087
8 SASI_Mm01_00244476 predicted 1060
9 SASI_Mm01_00244477 predicted 977
10 SASI_Mm01_00244478 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173503
EFCAB3 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-1233s1c1
Sequence:CCGGGCCAAGAATTACTTTCTCCTACTCGAGTAGGAGAAAGTAATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-771s1c1
Sequence:CCGGCCGGTTCAGATAGCCCATATTCTCGAGAATATGGGCTATCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-848s1c1
Sequence:CCGGCCATTCAAAGACATGCAGAAACTCGAGTTTCTGCATGTCTTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-313s1c1
Sequence:CCGGGCTGGGAATGAATCTGACCAACTCGAGTTGGTCAGATTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-535s1c1
Sequence:CCGGCCTACCCAGAAAGTCTATAATCTCGAGATTATAGACTTTCTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173503.3-402s21c1
Sequence:CCGGTATCAAGGTTCTAACAGATAACTCGAGTTATCTGTTAGAACCTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173503.3-994s21c1
Sequence:CCGGATCTTCACCATTGATCAAATGCTCGAGCATTTGATCAATGGTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173503
EFCAB3 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-1233s1c1
Sequence:CCGGGCCAAGAATTACTTTCTCCTACTCGAGTAGGAGAAAGTAATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-771s1c1
Sequence:CCGGCCGGTTCAGATAGCCCATATTCTCGAGAATATGGGCTATCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-848s1c1
Sequence:CCGGCCATTCAAAGACATGCAGAAACTCGAGTTTCTGCATGTCTTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-313s1c1
Sequence:CCGGGCTGGGAATGAATCTGACCAACTCGAGTTGGTCAGATTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-535s1c1
Sequence:CCGGCCTACCCAGAAAGTCTATAATCTCGAGATTATAGACTTTCTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173503.3-402s21c1
Sequence:CCGGTATCAAGGTTCTAACAGATAACTCGAGTTATCTGTTAGAACCTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173503.3-994s21c1
Sequence:CCGGATCTTCACCATTGATCAAATGCTCGAGCATTTGATCAATGGTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173503
EFCAB3 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-1233s1c1
Sequence:CCGGGCCAAGAATTACTTTCTCCTACTCGAGTAGGAGAAAGTAATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-771s1c1
Sequence:CCGGCCGGTTCAGATAGCCCATATTCTCGAGAATATGGGCTATCTGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-848s1c1
Sequence:CCGGCCATTCAAAGACATGCAGAAACTCGAGTTTCTGCATGTCTTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-313s1c1
Sequence:CCGGGCTGGGAATGAATCTGACCAACTCGAGTTGGTCAGATTCATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173503.1-535s1c1
Sequence:CCGGCCTACCCAGAAAGTCTATAATCTCGAGATTATAGACTTTCTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173503.3-402s21c1
Sequence:CCGGTATCAAGGTTCTAACAGATAACTCGAGTTATCTGTTAGAACCTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173503.3-994s21c1
Sequence:CCGGATCTTCACCATTGATCAAATGCTCGAGCATTTGATCAATGGTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081046
EFCAB3 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-771s21c1
Sequence:CCGGATAGAGCTAGTAAGCTATTTCCTCGAGGAAATAGCTTACTAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-1103s21c1
Sequence:CCGGGACTTTCTTTGAGGACTATTTCTCGAGAAATAGTCCTCAAAGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-1003s21c1
Sequence:CCGGTACCTGTGTTTCCGTTGTTTCCTCGAGGAAACAACGGAAACACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-496s21c1
Sequence:CCGGTTGATTCACACGGATTGATAACTCGAGTTATCAATCCGTGTGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-438s21c1
Sequence:CCGGCAACTTGAAGCCTTCCGTAATCTCGAGATTACGGAAGGCTTCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081046
EFCAB3 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-771s21c1
Sequence:CCGGATAGAGCTAGTAAGCTATTTCCTCGAGGAAATAGCTTACTAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-1103s21c1
Sequence:CCGGGACTTTCTTTGAGGACTATTTCTCGAGAAATAGTCCTCAAAGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-1003s21c1
Sequence:CCGGTACCTGTGTTTCCGTTGTTTCCTCGAGGAAACAACGGAAACACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-496s21c1
Sequence:CCGGTTGATTCACACGGATTGATAACTCGAGTTATCAATCCGTGTGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-438s21c1
Sequence:CCGGCAACTTGAAGCCTTCCGTAATCTCGAGATTACGGAAGGCTTCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081046
EFCAB3 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-771s21c1
Sequence:CCGGATAGAGCTAGTAAGCTATTTCCTCGAGGAAATAGCTTACTAGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-1103s21c1
Sequence:CCGGGACTTTCTTTGAGGACTATTTCTCGAGAAATAGTCCTCAAAGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-1003s21c1
Sequence:CCGGTACCTGTGTTTCCGTTGTTTCCTCGAGGAAACAACGGAAACACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-496s21c1
Sequence:CCGGTTGATTCACACGGATTGATAACTCGAGTTATCAATCCGTGTGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081046.1-438s21c1
Sequence:CCGGCAACTTGAAGCCTTCCGTAATCTCGAGATTACGGAAGGCTTCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks