EMAIL THIS PAGE TO A FRIEND

EFCAB4A

EF-hand calcium binding domain 4A

67 Gene Product Result for
Synonyms: CRACR2B
UniProtKB ID: Q8N4Y2, D5LPR2, Q8NBW8
Gene ID:
Mouse(213573) EF-hand calcium binding domain 4A
Rat(309112) EF-hand calcium binding domain 4A
Zebrafish(790936) EF-hand calcium binding domain 4A
cow(615055) EF-hand calcium binding domain 4A
domestic cat(101082010) EF-hand calcium binding domain 4A
dog(611409) EF-hand calcium binding domain 4A
naked mole-rat(101697371) EF-hand calcium binding domain 4A
domestic guinea pig(100716677) EF-hand calcium binding domain 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158911 MISSION® esiRNA esiRNA human EFCAB4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173584 Rosetta Predictions human pricing
NM_001127541 Rosetta Predictions rat pricing
NM_001025103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119527 predicted 632
2 SASI_Hs01_00119528 predicted 631
3 SASI_Hs01_00119530 predicted 630
4 SASI_Hs01_00119531 predicted 1539
5 SASI_Hs01_00119532 predicted 1572
6 SASI_Hs02_00368420 predicted 1542
7 SASI_Hs01_00119533 predicted 1566
8 SASI_Hs01_00119535 predicted 1140
9 SASI_Hs02_00368421 predicted 973
10 SASI_Hs02_00368422 predicted 637
11 SASI_Hs01_00119529 predicted 957
12 SASI_Hs01_00119534 predicted 955
13 SASI_Hs01_00119536 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254163 predicted 1215
2 SASI_Rn02_00254164 predicted 613
3 SASI_Rn02_00254165 predicted 1328
4 SASI_Rn02_00254166 predicted 1198
5 SASI_Rn02_00254167 predicted 498
6 SASI_Rn02_00254168 predicted 286
7 SASI_Rn02_00254169 predicted 320
8 SASI_Rn02_00254170 predicted 1214
9 SASI_Rn02_00254171 predicted 1246
10 SASI_Rn02_00254172 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086742 predicted 1024
2 SASI_Mm01_00086743 predicted 1001
3 SASI_Mm01_00086744 predicted 1106
4 SASI_Mm01_00086746 predicted 1016
5 SASI_Mm01_00086747 predicted 1119
6 SASI_Mm01_00086748 predicted 1022
7 SASI_Mm01_00086749 predicted 247
8 SASI_Mm01_00086750 predicted 566
9 SASI_Mm01_00086751 predicted 1097
10 SASI_Mm02_00287777 predicted 266
11 SASI_Mm01_00086745 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173584
EFCAB4A MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 4A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-524s1c1
Sequence:CCGGGCTGCAATACTGGAGCAGGCTCTCGAGAGCCTGCTCCAGTATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-1250s1c1
Sequence:CCGGGAACATGCAGAAAGAGAAAGTCTCGAGACTTTCTCTTTCTGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-961s1c1
Sequence:CCGGCTCTTTCGAGGATGTTCTGATCTCGAGATCAGAACATCCTCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-1247s1c1
Sequence:CCGGCAGGAACATGCAGAAAGAGAACTCGAGTTCTCTTTCTGCATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173584.2-550s1c1
Sequence:CCGGGCTGTTTCTGCTGTGTGACAACTCGAGTTGTCACACAGCAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173584.2-1256s1c1
Sequence:CCGGGCAGAAAGAGAAAGTCAGCCTCTCGAGAGGCTGACTTTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173584
EFCAB4A MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 4A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-524s1c1
Sequence:CCGGGCTGCAATACTGGAGCAGGCTCTCGAGAGCCTGCTCCAGTATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-1250s1c1
Sequence:CCGGGAACATGCAGAAAGAGAAAGTCTCGAGACTTTCTCTTTCTGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-961s1c1
Sequence:CCGGCTCTTTCGAGGATGTTCTGATCTCGAGATCAGAACATCCTCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-1247s1c1
Sequence:CCGGCAGGAACATGCAGAAAGAGAACTCGAGTTCTCTTTCTGCATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173584.2-550s1c1
Sequence:CCGGGCTGTTTCTGCTGTGTGACAACTCGAGTTGTCACACAGCAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173584.2-1256s1c1
Sequence:CCGGGCAGAAAGAGAAAGTCAGCCTCTCGAGAGGCTGACTTTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173584
EFCAB4A MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 4A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-524s1c1
Sequence:CCGGGCTGCAATACTGGAGCAGGCTCTCGAGAGCCTGCTCCAGTATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-1250s1c1
Sequence:CCGGGAACATGCAGAAAGAGAAAGTCTCGAGACTTTCTCTTTCTGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-961s1c1
Sequence:CCGGCTCTTTCGAGGATGTTCTGATCTCGAGATCAGAACATCCTCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173584.2-1247s1c1
Sequence:CCGGCAGGAACATGCAGAAAGAGAACTCGAGTTCTCTTTCTGCATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173584.2-550s1c1
Sequence:CCGGGCTGTTTCTGCTGTGTGACAACTCGAGTTGTCACACAGCAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173584.2-1256s1c1
Sequence:CCGGGCAGAAAGAGAAAGTCAGCCTCTCGAGAGGCTGACTTTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025103
EFCAB4A MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 4A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025103.1-1047s1c1
Sequence:CCGGGCAGAAAGAGAAACTCAGCCTCTCGAGAGGCTGAGTTTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1419s1c1
Sequence:CCGGCTTCAGTCTTTATCCTGTCTTCTCGAGAAGACAGGATAAAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1521s1c1
Sequence:CCGGGCTGTCCTCGAACTCAGAAATCTCGAGATTTCTGAGTTCGAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1410s1c1
Sequence:CCGGCCTTCAGTCCTTCAGTCTTTACTCGAGTAAAGACTGAAGGACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025103
EFCAB4A MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 4A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025103.1-1047s1c1
Sequence:CCGGGCAGAAAGAGAAACTCAGCCTCTCGAGAGGCTGAGTTTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1419s1c1
Sequence:CCGGCTTCAGTCTTTATCCTGTCTTCTCGAGAAGACAGGATAAAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1521s1c1
Sequence:CCGGGCTGTCCTCGAACTCAGAAATCTCGAGATTTCTGAGTTCGAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1410s1c1
Sequence:CCGGCCTTCAGTCCTTCAGTCTTTACTCGAGTAAAGACTGAAGGACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025103
EFCAB4A MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 4A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025103.1-1047s1c1
Sequence:CCGGGCAGAAAGAGAAACTCAGCCTCTCGAGAGGCTGAGTTTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1419s1c1
Sequence:CCGGCTTCAGTCTTTATCCTGTCTTCTCGAGAAGACAGGATAAAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1521s1c1
Sequence:CCGGGCTGTCCTCGAACTCAGAAATCTCGAGATTTCTGAGTTCGAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025103.1-1410s1c1
Sequence:CCGGCCTTCAGTCCTTCAGTCTTTACTCGAGTAAAGACTGAAGGACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks