EMAIL THIS PAGE TO A FRIEND

EFCAB4B

EF-hand calcium binding domain 4B

66 Gene Product Result for
Synonyms: CRACR2A
UniProtKB ID: Q9BSW2, B4E1X0, B9EK63
Gene ID:
Mouse(381812) EF-hand calcium binding domain 4B
Rat(500324) EF-hand calcium binding domain 4B
sheep(101117491) EF-hand calcium binding domain 4B
Domestic Rabbit(100342289) EF-hand calcium binding domain 4B
chicken(423106) EF-hand calcium binding domain 4B
domestic cat(101099812) EF-hand calcium binding domain 4B
cow(525377) EF-hand calcium binding domain 4B
dog(486739) EF-hand calcium binding domain 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0265 AQUA Peptide TSQQLQEAQQQLESLQ[R] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032680 Rosetta Predictions human pricing
XM_001065149 Rosetta Predictions rat pricing
XM_575675 Rosetta Predictions rat pricing
NM_001033464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104193 predicted 665
2 SASI_Hs01_00104194 predicted 977
3 SASI_Hs01_00104196 predicted 790
4 SASI_Hs02_00360217 predicted 1375
5 SASI_Hs01_00104197 predicted 1235
6 SASI_Hs01_00104198 predicted 1032
7 SASI_Hs01_00104199 predicted 1031
8 SASI_Hs01_00104202 predicted 809
9 SASI_Hs02_00360218 predicted 680
10 SASI_Hs02_00360219 predicted 1455
11 SASI_Hs01_00104195 predicted 1190
12 SASI_Hs01_00104200 predicted 806
13 SASI_Hs01_00104201 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313052 predicted 1919
2 SASI_Rn02_00313053 predicted 244
3 SASI_Rn02_00313054 predicted 1919
4 SASI_Rn02_00313055 predicted 1946
5 SASI_Rn02_00313056 predicted 699
6 SASI_Rn02_00313057 predicted 2086
7 SASI_Rn02_00313058 predicted 1852
8 SASI_Rn02_00313059 predicted 762
9 SASI_Rn02_00313060 predicted 1455
10 SASI_Rn02_00313061 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404087 predicted 1920
2 SASI_Rn02_00404088 predicted 244
3 SASI_Rn02_00404089 predicted 1916
4 SASI_Rn02_00404090 predicted 1948
5 SASI_Rn02_00404091 predicted 698
6 SASI_Rn02_00404092 predicted 2084
7 SASI_Rn02_00404093 predicted 1848
8 SASI_Rn02_00404094 predicted 763
9 SASI_Rn02_00404095 predicted 1459
10 SASI_Rn02_00404096 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127508 predicted 453
2 SASI_Mm02_00288812 predicted 780
3 SASI_Mm01_00127510 predicted 780
4 SASI_Mm01_00127511 predicted 762
5 SASI_Mm01_00127512 predicted 841
6 SASI_Mm01_00127513 predicted 541
7 SASI_Mm02_00288813 predicted 541
8 SASI_Mm01_00127515 predicted 533
9 SASI_Mm02_00288814 predicted 763
10 SASI_Mm01_00127516 predicted 588
11 SASI_Mm01_00127507 predicted 334
12 SASI_Mm01_00127509 predicted 470
13 SASI_Mm01_00127514 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032680
EFCAB4B MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-872s1c1
Sequence:CCGGCGCCATGAAGAGAAGGTGTATCTCGAGATACACCTTCTCTTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-796s1c1
Sequence:CCGGCACTACTGGATTTAGTCACTTCTCGAGAAGTGACTAAATCCAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-582s1c1
Sequence:CCGGAGAAGGAGACTCAGGAGCAAACTCGAGTTTGCTCCTGAGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-983s1c1
Sequence:CCGGGTGTTGGAAGATGAAAGTGATCTCGAGATCACTTTCATCTTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-1376s1c1
Sequence:CCGGGCTGAGAATACCAAGCTGAAACTCGAGTTTCAGCTTGGTATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032680.3-1978s21c1
Sequence:CCGGGCGAGCAGAGCTGGGTTTAATCTCGAGATTAAACCCAGCTCTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032680.3-1220s21c1
Sequence:CCGGTGAACTGGAGTGTGCCCTAAACTCGAGTTTAGGGCACACTCCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032680.3-1132s21c1
Sequence:CCGGAGAAGGAGGAACCTCATTTACCTCGAGGTAAATGAGGTTCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032680.3-1847s21c1
Sequence:CCGGACCAAGTAGCCACTCTATTATCTCGAGATAATAGAGTGGCTACTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032680
EFCAB4B MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-872s1c1
Sequence:CCGGCGCCATGAAGAGAAGGTGTATCTCGAGATACACCTTCTCTTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-796s1c1
Sequence:CCGGCACTACTGGATTTAGTCACTTCTCGAGAAGTGACTAAATCCAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-582s1c1
Sequence:CCGGAGAAGGAGACTCAGGAGCAAACTCGAGTTTGCTCCTGAGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-983s1c1
Sequence:CCGGGTGTTGGAAGATGAAAGTGATCTCGAGATCACTTTCATCTTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-1376s1c1
Sequence:CCGGGCTGAGAATACCAAGCTGAAACTCGAGTTTCAGCTTGGTATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032680.3-1978s21c1
Sequence:CCGGGCGAGCAGAGCTGGGTTTAATCTCGAGATTAAACCCAGCTCTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032680.3-1220s21c1
Sequence:CCGGTGAACTGGAGTGTGCCCTAAACTCGAGTTTAGGGCACACTCCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032680.3-1132s21c1
Sequence:CCGGAGAAGGAGGAACCTCATTTACCTCGAGGTAAATGAGGTTCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032680.3-1847s21c1
Sequence:CCGGACCAAGTAGCCACTCTATTATCTCGAGATAATAGAGTGGCTACTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032680
EFCAB4B MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-872s1c1
Sequence:CCGGCGCCATGAAGAGAAGGTGTATCTCGAGATACACCTTCTCTTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-796s1c1
Sequence:CCGGCACTACTGGATTTAGTCACTTCTCGAGAAGTGACTAAATCCAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-582s1c1
Sequence:CCGGAGAAGGAGACTCAGGAGCAAACTCGAGTTTGCTCCTGAGTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-983s1c1
Sequence:CCGGGTGTTGGAAGATGAAAGTGATCTCGAGATCACTTTCATCTTCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032680.2-1376s1c1
Sequence:CCGGGCTGAGAATACCAAGCTGAAACTCGAGTTTCAGCTTGGTATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032680.3-1978s21c1
Sequence:CCGGGCGAGCAGAGCTGGGTTTAATCTCGAGATTAAACCCAGCTCTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032680.3-1220s21c1
Sequence:CCGGTGAACTGGAGTGTGCCCTAAACTCGAGTTTAGGGCACACTCCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032680.3-1132s21c1
Sequence:CCGGAGAAGGAGGAACCTCATTTACCTCGAGGTAAATGAGGTTCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032680.3-1847s21c1
Sequence:CCGGACCAAGTAGCCACTCTATTATCTCGAGATAATAGAGTGGCTACTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033464
EFCAB4B MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 4B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-593s21c1
Sequence:CCGGATGATGAAGAAGCACAATTTCCTCGAGGAAATTGTGCTTCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-536s21c1
Sequence:CCGGTCCAAGAGGAGAAAGTGTATCCTCGAGGATACACTTTCTCCTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-453s21c1
Sequence:CCGGAGAGTTCACCACTGGATTTAGCTCGAGCTAAATCCAGTGGTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-642s21c1
Sequence:CCGGGAAAGTTCTGGAAGATGAAAGCTCGAGCTTTCATCTTCCAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-724s21c1
Sequence:CCGGGAAGACCTCCTCACCACAATTCTCGAGAATTGTGGTGAGGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033464
EFCAB4B MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 4B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-593s21c1
Sequence:CCGGATGATGAAGAAGCACAATTTCCTCGAGGAAATTGTGCTTCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-536s21c1
Sequence:CCGGTCCAAGAGGAGAAAGTGTATCCTCGAGGATACACTTTCTCCTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-453s21c1
Sequence:CCGGAGAGTTCACCACTGGATTTAGCTCGAGCTAAATCCAGTGGTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-642s21c1
Sequence:CCGGGAAAGTTCTGGAAGATGAAAGCTCGAGCTTTCATCTTCCAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-724s21c1
Sequence:CCGGGAAGACCTCCTCACCACAATTCTCGAGAATTGTGGTGAGGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033464
EFCAB4B MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 4B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-593s21c1
Sequence:CCGGATGATGAAGAAGCACAATTTCCTCGAGGAAATTGTGCTTCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-536s21c1
Sequence:CCGGTCCAAGAGGAGAAAGTGTATCCTCGAGGATACACTTTCTCCTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-453s21c1
Sequence:CCGGAGAGTTCACCACTGGATTTAGCTCGAGCTAAATCCAGTGGTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-642s21c1
Sequence:CCGGGAAAGTTCTGGAAGATGAAAGCTCGAGCTTTCATCTTCCAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033464.3-724s21c1
Sequence:CCGGGAAGACCTCCTCACCACAATTCTCGAGAATTGTGGTGAGGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks