EMAIL THIS PAGE TO A FRIEND

EFCAB5

EF-hand calcium binding domain 5

Gene ID:
Mouse(319634) EF-hand calcium binding domain 5
Rat(363653) EF-hand calcium binding domain 5
chicken(417587) EF-hand calcium binding domain 5
cow(525878) EF-hand calcium binding domain 5
Horse(100072197) EF-hand calcium binding domain 5
domestic cat(101082024) EF-hand calcium binding domain 5
dog(480634) EF-hand calcium binding domain 5
domestic guinea pig(100722899) EF-hand calcium binding domain 5
naked mole-rat(101710128) EF-hand calcium binding domain 5
sheep(101122536) EF-hand calcium binding domain 5
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033562 Rosetta Predictions human pricing
NM_198529 Rosetta Predictions human pricing
XM_001080780 Rosetta Predictions rat pricing
XM_343943 Rosetta Predictions rat pricing
NM_176965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194183 predicted 1017
2 SASI_Hs01_00194184 predicted 1455
3 SASI_Hs01_00194185 predicted 1784
4 SASI_Hs01_00194186 predicted 828
5 SASI_Hs01_00194187 predicted 2572
6 SASI_Hs01_00194188 predicted 1832
7 SASI_Hs01_00194189 predicted 1386
8 SASI_Hs01_00194190 predicted 1379
9 SASI_Hs01_00194191 predicted 815
10 SASI_Hs01_00194192 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372109 predicted 2826
2 SASI_Hs02_00372110 predicted 4267
3 SASI_Hs02_00372111 predicted 4177
4 SASI_Hs01_00244907 predicted 826
5 SASI_Hs02_00372112 predicted 2972
6 SASI_Hs02_00372113 predicted 2476
7 SASI_Hs02_00372114 predicted 4108
8 SASI_Hs02_00372115 predicted 4666
9 SASI_Hs02_00372116 predicted 4455
10 SASI_Hs02_00372117 predicted 3060
11 SASI_Hs01_00244904 predicted 1013
12 SASI_Hs01_00244905 predicted 1447
13 SASI_Hs01_00244906 predicted 1784
14 SASI_Hs01_00244908 predicted 2569
15 SASI_Hs01_00244909 predicted 1383
16 SASI_Hs01_00244910 predicted 1374
17 SASI_Hs01_00244911 predicted 821
18 SASI_Hs01_00244912 predicted 1257
19 SASI_Hs01_00244913 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369332 predicted 3508
2 SASI_Rn02_00369333 predicted 796
3 SASI_Rn02_00369334 predicted 3439
4 SASI_Rn02_00369335 predicted 3189
5 SASI_Rn02_00369336 predicted 2677
6 SASI_Rn02_00369337 predicted 4142
7 SASI_Rn02_00369338 predicted 4604
8 SASI_Rn02_00369339 predicted 2061
9 SASI_Rn02_00369340 predicted 3049
10 SASI_Rn02_00369341 predicted 3246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396575 predicted 718
2 SASI_Rn02_00396576 predicted 526
3 SASI_Rn02_00396577 predicted 2992
4 SASI_Rn02_00396578 predicted 2475
5 SASI_Rn02_00396579 predicted 567
6 SASI_Rn02_00396580 predicted 2364
7 SASI_Rn02_00396581 predicted 889
8 SASI_Rn02_00396582 predicted 1916
9 SASI_Rn02_00396583 predicted 2843
10 SASI_Rn02_00396584 predicted 2091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346869 predicted 1719
2 SASI_Mm01_00154955 predicted 1007
3 SASI_Mm01_00154956 predicted 878
4 SASI_Mm01_00154957 predicted 2454
5 SASI_Mm01_00154958 predicted 4042
6 SASI_Mm01_00154960 predicted 3040
7 SASI_Mm01_00154961 predicted 3657
8 SASI_Mm02_00346870 predicted 224
9 SASI_Mm02_00346871 predicted 389
10 SASI_Mm01_00154954 predicted 2543
11 SASI_Mm01_00154959 predicted 309
12 SASI_Mm01_00154962 predicted 3228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198529
EFCAB5 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198529.3-808s21c1
Sequence:CCGGAGCAAGTTTGACCCAATTAATCTCGAGATTAATTGGGTCAAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198529.3-3328s21c1
Sequence:CCGGACCTTAGATGATGCTCAATTTCTCGAGAAATTGAGCATCATCTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198529.1-3497s1c1
Sequence:CCGGCCTCCAAGACTGACAATTATACTCGAGTATAATTGTCAGTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198529.1-331s1c1
Sequence:CCGGCCTAAGTCAGTGATTCAGAATCTCGAGATTCTGAATCACTGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3805s1c1
Sequence:CCGGCCTTTCAGTTTGAGCTTTGTACTCGAGTACAAAGCTCAAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198529.1-1781s1c1
Sequence:CCGGCAGCTAAACTACACATCCAATCTCGAGATTGGATGTGTAGTTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198529.1-878s1c1
Sequence:CCGGGTCCAGATCAACCTAAACTTACTCGAGTAAGTTTAGGTTGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3756s1c1
Sequence:CCGGGCCATAGCCAAGTGTATTTAACTCGAGTTAAATACACTTGGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3832s1c1
Sequence:CCGGGTGGAACTGTTATGGTTGATTCTCGAGAATCAACCATAACAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198529
EFCAB5 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198529.3-808s21c1
Sequence:CCGGAGCAAGTTTGACCCAATTAATCTCGAGATTAATTGGGTCAAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198529.3-3328s21c1
Sequence:CCGGACCTTAGATGATGCTCAATTTCTCGAGAAATTGAGCATCATCTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198529.1-3497s1c1
Sequence:CCGGCCTCCAAGACTGACAATTATACTCGAGTATAATTGTCAGTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198529.1-331s1c1
Sequence:CCGGCCTAAGTCAGTGATTCAGAATCTCGAGATTCTGAATCACTGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3805s1c1
Sequence:CCGGCCTTTCAGTTTGAGCTTTGTACTCGAGTACAAAGCTCAAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198529.1-1781s1c1
Sequence:CCGGCAGCTAAACTACACATCCAATCTCGAGATTGGATGTGTAGTTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198529.1-878s1c1
Sequence:CCGGGTCCAGATCAACCTAAACTTACTCGAGTAAGTTTAGGTTGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3756s1c1
Sequence:CCGGGCCATAGCCAAGTGTATTTAACTCGAGTTAAATACACTTGGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3832s1c1
Sequence:CCGGGTGGAACTGTTATGGTTGATTCTCGAGAATCAACCATAACAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198529
EFCAB5 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198529.3-808s21c1
Sequence:CCGGAGCAAGTTTGACCCAATTAATCTCGAGATTAATTGGGTCAAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198529.3-3328s21c1
Sequence:CCGGACCTTAGATGATGCTCAATTTCTCGAGAAATTGAGCATCATCTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198529.1-3497s1c1
Sequence:CCGGCCTCCAAGACTGACAATTATACTCGAGTATAATTGTCAGTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198529.1-331s1c1
Sequence:CCGGCCTAAGTCAGTGATTCAGAATCTCGAGATTCTGAATCACTGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3805s1c1
Sequence:CCGGCCTTTCAGTTTGAGCTTTGTACTCGAGTACAAAGCTCAAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198529.1-1781s1c1
Sequence:CCGGCAGCTAAACTACACATCCAATCTCGAGATTGGATGTGTAGTTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198529.1-878s1c1
Sequence:CCGGGTCCAGATCAACCTAAACTTACTCGAGTAAGTTTAGGTTGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3756s1c1
Sequence:CCGGGCCATAGCCAAGTGTATTTAACTCGAGTTAAATACACTTGGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198529.1-3832s1c1
Sequence:CCGGGTGGAACTGTTATGGTTGATTCTCGAGAATCAACCATAACAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176965
EFCAB5 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.3-3161s1c1
Sequence:CCGGCTTACCTCATGAGATCAAATTCTCGAGAATTTGATCTCATGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.3-4053s1c1
Sequence:CCGGGAGCTCGTTACAAGCTATATCCTCGAGGATATAGCTTGTAACGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.2-2637s1c1
Sequence:CCGGGAATGAGTATAACGGGTCGTTCTCGAGAACGACCCGTTATACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176965.2-1712s1c1
Sequence:CCGGCAGACCTACATGCGACTATTACTCGAGTAATAGTCGCATGTAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176965.2-303s1c1
Sequence:CCGGCATGGATATTAAGAAGCACATCTCGAGATGTGCTTCTTAATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4064s1c1
Sequence:CCGGCGGAATACGTAATAGAATGTACTCGAGTACATTCTATTACGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4028s1c1
Sequence:CCGGGCATGCATTGATGATGACCATCTCGAGATGGTCATCATCAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4060s1c1
Sequence:CCGGCCAGCGGAATACGTAATAGAACTCGAGTTCTATTACGTATTCCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176965
EFCAB5 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.3-3161s1c1
Sequence:CCGGCTTACCTCATGAGATCAAATTCTCGAGAATTTGATCTCATGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.3-4053s1c1
Sequence:CCGGGAGCTCGTTACAAGCTATATCCTCGAGGATATAGCTTGTAACGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.2-2637s1c1
Sequence:CCGGGAATGAGTATAACGGGTCGTTCTCGAGAACGACCCGTTATACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176965.2-1712s1c1
Sequence:CCGGCAGACCTACATGCGACTATTACTCGAGTAATAGTCGCATGTAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176965.2-303s1c1
Sequence:CCGGCATGGATATTAAGAAGCACATCTCGAGATGTGCTTCTTAATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4064s1c1
Sequence:CCGGCGGAATACGTAATAGAATGTACTCGAGTACATTCTATTACGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4028s1c1
Sequence:CCGGGCATGCATTGATGATGACCATCTCGAGATGGTCATCATCAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4060s1c1
Sequence:CCGGCCAGCGGAATACGTAATAGAACTCGAGTTCTATTACGTATTCCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176965
EFCAB5 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.3-3161s1c1
Sequence:CCGGCTTACCTCATGAGATCAAATTCTCGAGAATTTGATCTCATGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.3-4053s1c1
Sequence:CCGGGAGCTCGTTACAAGCTATATCCTCGAGGATATAGCTTGTAACGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176965.2-2637s1c1
Sequence:CCGGGAATGAGTATAACGGGTCGTTCTCGAGAACGACCCGTTATACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176965.2-1712s1c1
Sequence:CCGGCAGACCTACATGCGACTATTACTCGAGTAATAGTCGCATGTAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176965.2-303s1c1
Sequence:CCGGCATGGATATTAAGAAGCACATCTCGAGATGTGCTTCTTAATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4064s1c1
Sequence:CCGGCGGAATACGTAATAGAATGTACTCGAGTACATTCTATTACGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4028s1c1
Sequence:CCGGGCATGCATTGATGATGACCATCTCGAGATGGTCATCATCAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176965.2-4060s1c1
Sequence:CCGGCCAGCGGAATACGTAATAGAACTCGAGTTCTATTACGTATTCCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks