EMAIL THIS PAGE TO A FRIEND

EFCAB6

EF-hand calcium binding domain 6

71 Gene Product Result for
Synonyms: DJBP HSCBCIP1 dJ185D5.1
Gene ID:
Human(64800) Summary: This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(77627) EF-hand calcium binding domain 6
Rat(315179) EF-hand calcium binding domain 6
sheep(101117152) EF-hand calcium binding domain 6
naked mole-rat(101710667) EF-hand calcium binding domain 6
domestic guinea pig(100726392) EF-hand calcium binding domain 6
Zebrafish(100151092) EF-hand calcium binding domain 6
cow(535401) EF-hand calcium binding domain 6
Horse(100050242) EF-hand calcium binding domain 6
domestic cat(101092867) EF-hand calcium binding domain 6
dog(481218) EF-hand calcium binding domain 6
chicken(418231) EF-hand calcium binding domain 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022785 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022785 Rosetta Predictions human pricing
NM_198856 Rosetta Predictions human pricing
XM_001077962 Rosetta Predictions rat pricing
XM_235526 Rosetta Predictions rat pricing
NM_029946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234458 predicted 2708
2 SASI_Hs01_00234459 predicted 4570
3 SASI_Hs01_00234460 predicted 3811
4 SASI_Hs01_00234461 predicted 2056
5 SASI_Hs02_00356085 predicted 2492
6 SASI_Hs01_00234462 predicted 1485
7 SASI_Hs01_00234465 predicted 1714
8 SASI_Hs02_00356086 predicted 1590
9 SASI_Hs02_00356087 predicted 4403
10 SASI_Hs01_00234466 predicted 1580
11 SASI_Hs01_00234463 predicted 4349
12 SASI_Hs01_00234464 predicted 2025
13 SASI_Hs01_00234467 predicted 2948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089539 predicted 2346
2 SASI_Hs01_00089540 predicted 4213
3 SASI_Hs01_00089541 predicted 3450
4 SASI_Hs01_00089542 predicted 1697
5 SASI_Hs02_00372372 predicted 2139
6 SASI_Hs01_00089543 predicted 1119
7 SASI_Hs01_00089546 predicted 1357
8 SASI_Hs02_00372373 predicted 1241
9 SASI_Hs02_00372374 predicted 4049
10 SASI_Hs01_00089547 predicted 1230
11 SASI_Hs01_00089544 predicted 4001
12 SASI_Hs01_00089545 predicted 1670
13 SASI_Hs01_00089548 predicted 2592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359141 predicted 3538
2 SASI_Rn02_00359142 predicted 1163
3 SASI_Rn02_00359143 predicted 359
4 SASI_Rn02_00359144 predicted 3709
5 SASI_Rn02_00359145 predicted 923
6 SASI_Rn02_00359146 predicted 403
7 SASI_Rn02_00359147 predicted 1962
8 SASI_Rn02_00359148 predicted 507
9 SASI_Rn02_00359149 predicted 3486
10 SASI_Rn02_00359150 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389420 predicted 1178
2 SASI_Rn02_00389421 predicted 1615
3 SASI_Rn02_00389422 predicted 1449
4 SASI_Rn02_00389423 predicted 1202
5 SASI_Rn02_00389424 predicted 1281
6 SASI_Rn02_00389425 predicted 738
7 SASI_Rn02_00389426 predicted 1169
8 SASI_Rn02_00389427 predicted 1310
9 SASI_Rn02_00389428 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336243 predicted 4564
2 SASI_Mm02_00336244 predicted 2338
3 SASI_Mm01_00186086 predicted 1826
4 SASI_Mm01_00186087 predicted 1798
5 SASI_Mm01_00186088 predicted 216
6 SASI_Mm01_00186089 predicted 367
7 SASI_Mm01_00186090 predicted 1131
8 SASI_Mm02_00336245 predicted 2150
9 SASI_Mm01_00186093 predicted 565
10 SASI_Mm02_00336246 predicted 2029
11 SASI_Mm01_00186085 predicted 3517
12 SASI_Mm01_00186091 predicted 2102
13 SASI_Mm01_00186092 predicted 1349
14 SASI_Mm01_00186094 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029946
EFCAB6 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1505s1c1
Sequence:CCGGGCGAAGTTAAACGACTCAGAACTCGAGTTCTGAGTCGTTTAACTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-3865s1c1
Sequence:CCGGGAGGCTAAAGTACCAGGACTTCTCGAGAAGTCCTGGTACTTTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1264s1c1
Sequence:CCGGGCAGTTTCTTACAGCAATTTACTCGAGTAAATTGCTGTAAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-1415s21c1
Sequence:CCGGGCCCTGAAGAAGACCTTATTACTCGAGTAATAAGGTCTTCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-515s21c1
Sequence:CCGGCCGCTCACCAAAGATCAATTCCTCGAGGAATTGATCTTTGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029946.3-4742s21c1
Sequence:CCGGCCAGACAATGGAGGGCTTTAGCTCGAGCTAAAGCCCTCCATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-819s21c1
Sequence:CCGGGGATGCAGGATGGTGATTATGCTCGAGCATAATCACCATCCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1415s1c1
Sequence:CCGGGCCCTGAAGAAGACCTTATTACTCGAGTAATAAGGTCTTCTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-633s21c1
Sequence:CCGGATGGTATAAAGAGGGTAAATGCTCGAGCATTTACCCTCTTTATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029946
EFCAB6 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1505s1c1
Sequence:CCGGGCGAAGTTAAACGACTCAGAACTCGAGTTCTGAGTCGTTTAACTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-3865s1c1
Sequence:CCGGGAGGCTAAAGTACCAGGACTTCTCGAGAAGTCCTGGTACTTTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1264s1c1
Sequence:CCGGGCAGTTTCTTACAGCAATTTACTCGAGTAAATTGCTGTAAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-1415s21c1
Sequence:CCGGGCCCTGAAGAAGACCTTATTACTCGAGTAATAAGGTCTTCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-515s21c1
Sequence:CCGGCCGCTCACCAAAGATCAATTCCTCGAGGAATTGATCTTTGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029946.3-4742s21c1
Sequence:CCGGCCAGACAATGGAGGGCTTTAGCTCGAGCTAAAGCCCTCCATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-819s21c1
Sequence:CCGGGGATGCAGGATGGTGATTATGCTCGAGCATAATCACCATCCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1415s1c1
Sequence:CCGGGCCCTGAAGAAGACCTTATTACTCGAGTAATAAGGTCTTCTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-633s21c1
Sequence:CCGGATGGTATAAAGAGGGTAAATGCTCGAGCATTTACCCTCTTTATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029946
EFCAB6 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1505s1c1
Sequence:CCGGGCGAAGTTAAACGACTCAGAACTCGAGTTCTGAGTCGTTTAACTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-3865s1c1
Sequence:CCGGGAGGCTAAAGTACCAGGACTTCTCGAGAAGTCCTGGTACTTTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1264s1c1
Sequence:CCGGGCAGTTTCTTACAGCAATTTACTCGAGTAAATTGCTGTAAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-1415s21c1
Sequence:CCGGGCCCTGAAGAAGACCTTATTACTCGAGTAATAAGGTCTTCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-515s21c1
Sequence:CCGGCCGCTCACCAAAGATCAATTCCTCGAGGAATTGATCTTTGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029946.3-4742s21c1
Sequence:CCGGCCAGACAATGGAGGGCTTTAGCTCGAGCTAAAGCCCTCCATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-819s21c1
Sequence:CCGGGGATGCAGGATGGTGATTATGCTCGAGCATAATCACCATCCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029946.3-1415s1c1
Sequence:CCGGGCCCTGAAGAAGACCTTATTACTCGAGTAATAAGGTCTTCTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029946.3-633s21c1
Sequence:CCGGATGGTATAAAGAGGGTAAATGCTCGAGCATTTACCCTCTTTATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022785
EFCAB6 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-2074s1c1
Sequence:CCGGCCACAGAAGAAGTGATTGAAACTCGAGTTTCAATCACTTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-3261s1c1
Sequence:CCGGCGGCATGATAATGCTATCAATCTCGAGATTGATAGCATTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-894s1c1
Sequence:CCGGGCAGTAGATTACAACGTGTTTCTCGAGAAACACGTTGTAATCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-385s1c1
Sequence:CCGGCCTTAGATGTTAAACGGATTTCTCGAGAAATCCGTTTAACATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-4328s1c1
Sequence:CCGGCGACTTAAAGAGCAACGGGAACTCGAGTTCCCGTTGCTCTTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-4571s21c1
Sequence:CCGGGCTGCTAAGCGTCGCAGATTTCTCGAGAAATCTGCGACGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-1465s21c1
Sequence:CCGGCTAAACCCGATGGACCGATAACTCGAGTTATCGGTCCATCGGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-1743s21c1
Sequence:CCGGTATAACATGCTACGCTCATATCTCGAGATATGAGCGTAGCATGTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022785
EFCAB6 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-2074s1c1
Sequence:CCGGCCACAGAAGAAGTGATTGAAACTCGAGTTTCAATCACTTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-3261s1c1
Sequence:CCGGCGGCATGATAATGCTATCAATCTCGAGATTGATAGCATTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-894s1c1
Sequence:CCGGGCAGTAGATTACAACGTGTTTCTCGAGAAACACGTTGTAATCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-385s1c1
Sequence:CCGGCCTTAGATGTTAAACGGATTTCTCGAGAAATCCGTTTAACATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-4328s1c1
Sequence:CCGGCGACTTAAAGAGCAACGGGAACTCGAGTTCCCGTTGCTCTTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-4571s21c1
Sequence:CCGGGCTGCTAAGCGTCGCAGATTTCTCGAGAAATCTGCGACGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-1465s21c1
Sequence:CCGGCTAAACCCGATGGACCGATAACTCGAGTTATCGGTCCATCGGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-1743s21c1
Sequence:CCGGTATAACATGCTACGCTCATATCTCGAGATATGAGCGTAGCATGTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022785
EFCAB6 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-2074s1c1
Sequence:CCGGCCACAGAAGAAGTGATTGAAACTCGAGTTTCAATCACTTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-3261s1c1
Sequence:CCGGCGGCATGATAATGCTATCAATCTCGAGATTGATAGCATTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-894s1c1
Sequence:CCGGGCAGTAGATTACAACGTGTTTCTCGAGAAACACGTTGTAATCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-385s1c1
Sequence:CCGGCCTTAGATGTTAAACGGATTTCTCGAGAAATCCGTTTAACATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022785.2-4328s1c1
Sequence:CCGGCGACTTAAAGAGCAACGGGAACTCGAGTTCCCGTTGCTCTTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-4571s21c1
Sequence:CCGGGCTGCTAAGCGTCGCAGATTTCTCGAGAAATCTGCGACGCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-1465s21c1
Sequence:CCGGCTAAACCCGATGGACCGATAACTCGAGTTATCGGTCCATCGGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022785.2-1743s21c1
Sequence:CCGGTATAACATGCTACGCTCATATCTCGAGATATGAGCGTAGCATGTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks