EMAIL THIS PAGE TO A FRIEND

EFCAB7

EF-hand calcium binding domain 7

63 Gene Product Result for
Synonyms: RP4-534K7.1
UniProtKB ID: A8K855, Q658P0, Q96B95, Q96JM6
Gene ID:
Mouse(230500) EF-hand calcium binding domain 7
Rat(362549) EF-hand calcium binding domain 7
Zebrafish(415210) EF-hand calcium binding domain 7
cow(505160) EF-hand calcium binding domain 7
Horse(100070051) EF-hand calcium binding domain 7
chicken(100858847) EF-hand calcium binding domain 7
domestic cat(101083095) EF-hand calcium binding domain 7
dog(479546) EF-hand calcium binding domain 7
domestic guinea pig(100728294) EF-hand calcium binding domain 7
naked mole-rat(101712928) EF-hand calcium binding domain 7
sheep(101108968) EF-hand calcium binding domain 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371257 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032437 Rosetta Predictions human pricing
XM_001056277 Rosetta Predictions rat pricing
XM_342870 Rosetta Predictions rat pricing
NM_145549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158634 predicted 1001
2 SASI_Hs01_00158635 predicted 459
3 SASI_Hs01_00158637 predicted 1485
4 SASI_Hs01_00158639 predicted 1809
5 SASI_Hs01_00158640 predicted 1616
6 SASI_Hs01_00158641 predicted 1193
7 SASI_Hs01_00158642 predicted 1597
8 SASI_Hs02_00359846 predicted 1235
9 SASI_Hs02_00359847 predicted 1335
10 SASI_Hs02_00359848 predicted 1798
11 SASI_Hs01_00158636 predicted 280
12 SASI_Hs01_00158638 predicted 412
13 SASI_Hs01_00158643 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282755 predicted 1176
2 SASI_Rn02_00282756 predicted 1076
3 SASI_Rn02_00282757 predicted 1031
4 SASI_Rn02_00282758 predicted 1880
5 SASI_Rn02_00282759 predicted 857
6 SASI_Rn02_00282760 predicted 530
7 SASI_Rn02_00282761 predicted 1063
8 SASI_Rn02_00282762 predicted 1085
9 SASI_Rn02_00282763 predicted 1948
10 SASI_Rn02_00282764 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394921 predicted 1175
2 SASI_Rn02_00394922 predicted 1078
3 SASI_Rn02_00394923 predicted 630
4 SASI_Rn02_00394924 predicted 1029
5 SASI_Rn02_00394925 predicted 807
6 SASI_Rn02_00394926 predicted 851
7 SASI_Rn02_00394927 predicted 872
8 SASI_Rn02_00394928 predicted 531
9 SASI_Rn02_00394929 predicted 1063
10 SASI_Rn02_00394930 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091574 predicted 1592
2 SASI_Mm01_00091575 predicted 1074
3 SASI_Mm01_00091576 predicted 1816
4 SASI_Mm02_00341038 predicted 1284
5 SASI_Mm01_00091578 predicted 813
6 SASI_Mm01_00091579 predicted 1015
7 SASI_Mm01_00091580 predicted 971
8 SASI_Mm02_00341039 predicted 475
9 SASI_Mm01_00091581 predicted 747
10 SASI_Mm01_00091582 predicted 1025
11 SASI_Mm01_00091577 predicted 965
12 SASI_Mm01_00091583 predicted 1737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145549
VALIDATED
EFCAB7 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145549.1-963s21c1
Sequence:CCGGCTAACAATTAAGCCGTTATATCTCGAGATATAACGGCTTAATTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145549.1-1509s21c1
Sequence:CCGGCTGCATTCCATGGGCTATAATCTCGAGATTATAGCCCATGGAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-819s21c1
Sequence:CCGGAGTAACCAAGACTCAACATTACTCGAGTAATGTTGAGTCTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145549.1-1662s1c1
Sequence:CCGGCTTGATAGAAGCGATGCTAAACTCGAGTTTAGCATCGCTTCTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-686s21c1
Sequence:CCGGACCGTCACCTAGGGTCATAAGCTCGAGCTTATGACCCTAGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-1959s21c1
Sequence:CCGGGCTATCAAACTAAGAAGTATTCTCGAGAATACTTCTTAGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145549.1-1951s1c1
Sequence:CCGGCATTTGGAGCTATCAAACTAACTCGAGTTAGTTTGATAGCTCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145549.1-755s1c1
Sequence:CCGGCTTACTGTCAACAACTAGAAACTCGAGTTTCTAGTTGTTGACAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145549
VALIDATED
EFCAB7 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145549.1-963s21c1
Sequence:CCGGCTAACAATTAAGCCGTTATATCTCGAGATATAACGGCTTAATTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145549.1-1509s21c1
Sequence:CCGGCTGCATTCCATGGGCTATAATCTCGAGATTATAGCCCATGGAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-819s21c1
Sequence:CCGGAGTAACCAAGACTCAACATTACTCGAGTAATGTTGAGTCTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145549.1-1662s1c1
Sequence:CCGGCTTGATAGAAGCGATGCTAAACTCGAGTTTAGCATCGCTTCTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-686s21c1
Sequence:CCGGACCGTCACCTAGGGTCATAAGCTCGAGCTTATGACCCTAGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-1959s21c1
Sequence:CCGGGCTATCAAACTAAGAAGTATTCTCGAGAATACTTCTTAGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145549.1-1951s1c1
Sequence:CCGGCATTTGGAGCTATCAAACTAACTCGAGTTAGTTTGATAGCTCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145549.1-755s1c1
Sequence:CCGGCTTACTGTCAACAACTAGAAACTCGAGTTTCTAGTTGTTGACAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145549
VALIDATED
EFCAB7 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145549.1-963s21c1
Sequence:CCGGCTAACAATTAAGCCGTTATATCTCGAGATATAACGGCTTAATTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145549.1-1509s21c1
Sequence:CCGGCTGCATTCCATGGGCTATAATCTCGAGATTATAGCCCATGGAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-819s21c1
Sequence:CCGGAGTAACCAAGACTCAACATTACTCGAGTAATGTTGAGTCTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145549.1-1662s1c1
Sequence:CCGGCTTGATAGAAGCGATGCTAAACTCGAGTTTAGCATCGCTTCTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-686s21c1
Sequence:CCGGACCGTCACCTAGGGTCATAAGCTCGAGCTTATGACCCTAGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145549.1-1959s21c1
Sequence:CCGGGCTATCAAACTAAGAAGTATTCTCGAGAATACTTCTTAGTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145549.1-1951s1c1
Sequence:CCGGCATTTGGAGCTATCAAACTAACTCGAGTTAGTTTGATAGCTCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145549.1-755s1c1
Sequence:CCGGCTTACTGTCAACAACTAGAAACTCGAGTTTCTAGTTGTTGACAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371257
EFCAB7 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1330s1c1
Sequence:CCGGCCTGGAATTTACTGGTTAATTCTCGAGAATTAACCAGTAAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-445s1c1
Sequence:CCGGGCAGGAAGAAATCCATCCCAACTCGAGTTGGGATGGATTTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-2020s1c1
Sequence:CCGGCTCAACATATTTGCAGTAGAACTCGAGTTCTACTGCAAATATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1870s1c1
Sequence:CCGGGCCAAAGTAATGGATGGCTATCTCGAGATAGCCATCCATTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1225s1c1
Sequence:CCGGGCCTTGTATATTCTCAAGGAACTCGAGTTCCTTGAGAATATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371257
EFCAB7 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1330s1c1
Sequence:CCGGCCTGGAATTTACTGGTTAATTCTCGAGAATTAACCAGTAAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-445s1c1
Sequence:CCGGGCAGGAAGAAATCCATCCCAACTCGAGTTGGGATGGATTTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-2020s1c1
Sequence:CCGGCTCAACATATTTGCAGTAGAACTCGAGTTCTACTGCAAATATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1870s1c1
Sequence:CCGGGCCAAAGTAATGGATGGCTATCTCGAGATAGCCATCCATTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1225s1c1
Sequence:CCGGGCCTTGTATATTCTCAAGGAACTCGAGTTCCTTGAGAATATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371257
EFCAB7 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1330s1c1
Sequence:CCGGCCTGGAATTTACTGGTTAATTCTCGAGAATTAACCAGTAAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-445s1c1
Sequence:CCGGGCAGGAAGAAATCCATCCCAACTCGAGTTGGGATGGATTTCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-2020s1c1
Sequence:CCGGCTCAACATATTTGCAGTAGAACTCGAGTTCTACTGCAAATATGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1870s1c1
Sequence:CCGGGCCAAAGTAATGGATGGCTATCTCGAGATAGCCATCCATTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371257.1-1225s1c1
Sequence:CCGGGCCTTGTATATTCTCAAGGAACTCGAGTTCCTTGAGAATATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks