EMAIL THIS PAGE TO A FRIEND

EFCAB8

EF-hand calcium binding domain 8

58 Gene Product Result for
UniProtKB ID: A8MWE9
Gene ID:
Mouse(100504221) EF-hand calcium binding domain 8
Rat(499923) EF-hand calcium binding domain 8
naked mole-rat(101725013) EF-hand calcium binding domain 8
cow(783331) EF-hand calcium binding domain 8
domestic cat(101100460) EF-hand calcium binding domain 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143967 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720320 Rosetta Predictions human pricing
XM_371397 Rosetta Predictions human pricing
XM_936526 Rosetta Predictions human pricing
XM_001063637 Rosetta Predictions rat pricing
XM_575267 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00435915 predicted 4081
2 SASI_Hs02_00435916 predicted 1510
3 SASI_Hs02_00435917 predicted 1499
4 SASI_Hs02_00435918 predicted 2827
5 SASI_Hs02_00435919 predicted 2639
6 SASI_Hs02_00435920 predicted 3280
7 SASI_Hs02_00435921 predicted 1284
8 SASI_Hs02_00435922 predicted 3050
9 SASI_Hs02_00435923 predicted 2309
10 SASI_Hs02_00435924 predicted 3685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287771 predicted 4074
2 SASI_Hs02_00479313 predicted 1511
3 SASI_Hs01_00287773 predicted 4420
4 SASI_Hs02_00479314 predicted 1501
5 SASI_Hs01_00287776 predicted 3280
6 SASI_Hs02_00479315 predicted 3047
7 SASI_Hs01_00287777 predicted 3487
8 SASI_Hs01_00287778 predicted 2315
9 SASI_Hs01_00287779 predicted 2641
10 SASI_Hs02_00479316 predicted 1536
11 SASI_Hs01_00287772 predicted 2955
12 SASI_Hs01_00287774 predicted 2650
13 SASI_Hs01_00287775 predicted 1119
14 SASI_Hs01_00287780 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482113 predicted 4081
2 SASI_Hs02_00482114 predicted 1513
3 SASI_Hs02_00482115 predicted 1497
4 SASI_Hs02_00482116 predicted 2825
5 SASI_Hs02_00482117 predicted 2637
6 SASI_Hs02_00482118 predicted 3281
7 SASI_Hs02_00482119 predicted 1288
8 SASI_Hs02_00482120 predicted 3042
9 SASI_Hs02_00482121 predicted 3481
10 SASI_Hs02_00482122 predicted 2310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307885 predicted 2050
2 SASI_Rn02_00307886 predicted 1511
3 SASI_Rn02_00307887 predicted 1455
4 SASI_Rn02_00307888 predicted 2391
5 SASI_Rn02_00307889 predicted 3067
6 SASI_Rn02_00307890 predicted 669
7 SASI_Rn02_00307891 predicted 2026
8 SASI_Rn02_00307892 predicted 430
9 SASI_Rn02_00307893 predicted 369
10 SASI_Rn02_00307894 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403410 predicted 2056
2 SASI_Rn02_00403411 predicted 1506
3 SASI_Rn02_00403412 predicted 1451
4 SASI_Rn02_00403413 predicted 2391
5 SASI_Rn02_00403414 predicted 3063
6 SASI_Rn02_00403415 predicted 671
7 SASI_Rn02_00403416 predicted 2026
8 SASI_Rn02_00403417 predicted 433
9 SASI_Rn02_00403418 predicted 369
10 SASI_Rn02_00403419 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143967
EFCAB8 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1534s21c1
Sequence:CCGGCTACTCAATCGGGATCCTAAACTCGAGTTTAGGATCCCGATTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1182s21c1
Sequence:CCGGGGTTGTCAGTGCTGCGTTTAACTCGAGTTAAACGCAGCACTGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1879s21c1
Sequence:CCGGGATTAGTGGGATTATCCATATCTCGAGATATGGATAATCCCACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-3397s21c1
Sequence:CCGGAGTCTTGGGAGCGGCGTATAACTCGAGTTATACGCCGCTCCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-888s21c1
Sequence:CCGGACGCCAAAGGCAACGTCATTGCTCGAGCAATGACGTTGCCTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143967
EFCAB8 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1534s21c1
Sequence:CCGGCTACTCAATCGGGATCCTAAACTCGAGTTTAGGATCCCGATTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1182s21c1
Sequence:CCGGGGTTGTCAGTGCTGCGTTTAACTCGAGTTAAACGCAGCACTGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1879s21c1
Sequence:CCGGGATTAGTGGGATTATCCATATCTCGAGATATGGATAATCCCACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-3397s21c1
Sequence:CCGGAGTCTTGGGAGCGGCGTATAACTCGAGTTATACGCCGCTCCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-888s21c1
Sequence:CCGGACGCCAAAGGCAACGTCATTGCTCGAGCAATGACGTTGCCTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143967
EFCAB8 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1534s21c1
Sequence:CCGGCTACTCAATCGGGATCCTAAACTCGAGTTTAGGATCCCGATTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1182s21c1
Sequence:CCGGGGTTGTCAGTGCTGCGTTTAACTCGAGTTAAACGCAGCACTGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-1879s21c1
Sequence:CCGGGATTAGTGGGATTATCCATATCTCGAGATATGGATAATCCCACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-3397s21c1
Sequence:CCGGAGTCTTGGGAGCGGCGTATAACTCGAGTTATACGCCGCTCCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143967.1-888s21c1
Sequence:CCGGACGCCAAAGGCAACGTCATTGCTCGAGCAATGACGTTGCCTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks