EMAIL THIS PAGE TO A FRIEND

EFCAB9

EF-hand calcium binding domain 9

72 Gene Product Result for
UniProtKB ID: A8MZ26
Gene ID:
Mouse(69306) EF-hand calcium binding domain 9
Rat(688481) EF-hand calcium binding domain 9
cow(618333) EF-hand calcium binding domain 9
domestic cat(101092417) EF-hand calcium binding domain 9
dog(479290) EF-hand calcium binding domain 9
domestic guinea pig(100716558) EF-hand calcium binding domain 9
naked mole-rat(101699385) EF-hand calcium binding domain 9
sheep(101105778) EF-hand calcium binding domain 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715066 Rosetta Predictions human pricing
XM_001715900 Rosetta Predictions human pricing
XM_209668 Rosetta Predictions human pricing
XM_941052 Rosetta Predictions human pricing
XM_001067118 Rosetta Predictions rat pricing
NM_027031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401272 predicted 214
2 SASI_Hs02_00401273 predicted 275
3 SASI_Hs02_00401274 predicted 292
4 SASI_Hs02_00401275 predicted 225
5 SASI_Hs02_00401276 predicted 235
6 SASI_Hs02_00401277 predicted 219
7 SASI_Hs02_00401278 predicted 277
8 SASI_Hs02_00401279 predicted 285
9 SASI_Hs02_00401280 predicted 222
10 SASI_Hs02_00401281 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406869 predicted 221
2 SASI_Hs02_00406870 predicted 275
3 SASI_Hs02_00406871 predicted 289
4 SASI_Hs02_00406872 predicted 225
5 SASI_Hs02_00406873 predicted 234
6 SASI_Hs02_00406874 predicted 218
7 SASI_Hs02_00406875 predicted 279
8 SASI_Hs02_00406876 predicted 288
9 SASI_Hs02_00406877 predicted 227
10 SASI_Hs02_00406878 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292643 predicted 226
2 SASI_Hs01_00292644 predicted 233
3 SASI_Hs01_00292645 predicted 229
4 SASI_Hs01_00292646 predicted 232
5 SASI_Hs01_00292647 predicted 232
6 SASI_Hs01_00292648 predicted 233
7 SASI_Hs01_00292649 predicted 224
8 SASI_Hs01_00292650 predicted 223
9 SASI_Hs01_00292651 predicted 220
10 SASI_Hs01_00292652 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484609 predicted 218
2 SASI_Hs02_00484610 predicted 281
3 SASI_Hs02_00484611 predicted 288
4 SASI_Hs02_00484612 predicted 233
5 SASI_Hs02_00484613 predicted 226
6 SASI_Hs02_00484614 predicted 215
7 SASI_Hs02_00484615 predicted 281
8 SASI_Hs02_00484616 predicted 287
9 SASI_Hs02_00484617 predicted 219
10 SASI_Hs02_00484618 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319902 predicted 271
2 SASI_Rn02_00319903 predicted 338
3 SASI_Rn02_00319904 predicted 239
4 SASI_Rn02_00319905 predicted 273
5 SASI_Rn02_00319906 predicted 260
6 SASI_Rn02_00319907 predicted 331
7 SASI_Rn02_00319908 predicted 301
8 SASI_Rn02_00319909 predicted 308
9 SASI_Rn02_00319910 predicted 218
10 SASI_Rn02_00319911 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034356 predicted 232
2 SASI_Mm02_00331426 predicted 231
3 SASI_Mm01_00034357 predicted 300
4 SASI_Mm01_00034359 predicted 279
5 SASI_Mm01_00034361 predicted 218
6 SASI_Mm02_00331427 predicted 256
7 SASI_Mm01_00034363 predicted 232
8 SASI_Mm01_00034364 predicted 250
9 SASI_Mm01_00034365 predicted 235
10 SASI_Mm02_00331428 predicted 268
11 SASI_Mm01_00034358 predicted 346
12 SASI_Mm01_00034360 predicted 333
13 SASI_Mm01_00034362 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027031
EFCAB9 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-417s1c1
Sequence:CCGGGAATATAGGTGCGGCCAATTTCTCGAGAAATTGGCCGCACCTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-535s1c1
Sequence:CCGGGAATTTAAGCTGTACACAATCCTCGAGGATTGTGTACAGCTTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-444s1c1
Sequence:CCGGCTACAGATTTCTCTTCAATATCTCGAGATATTGAAGAGAAATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-303s1c1
Sequence:CCGGCCAGTTCTATGTGTTGATTTGCTCGAGCAAATCAACACATAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.1-551s1c1
Sequence:CCGGCACAATCTTCTGCACCGACAACTCGAGTTGTCGGTGCAGAAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-565s1c1
Sequence:CCGGCCGACAAATCCATAGACAGAACTCGAGTTCTGTCTATGGATTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-177s1c1
Sequence:CCGGCACAGGAACACCTTGAATGATCTCGAGATCATTCAAGGTGTTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-141s1c1
Sequence:CCGGGCCTTGATGGTGTACTTTCATCTCGAGATGAAAGTACACCATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-242s1c1
Sequence:CCGGGTCACAGATCGGGATGATATTCTCGAGAATATCATCCCGATCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027031
EFCAB9 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-417s1c1
Sequence:CCGGGAATATAGGTGCGGCCAATTTCTCGAGAAATTGGCCGCACCTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-535s1c1
Sequence:CCGGGAATTTAAGCTGTACACAATCCTCGAGGATTGTGTACAGCTTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-444s1c1
Sequence:CCGGCTACAGATTTCTCTTCAATATCTCGAGATATTGAAGAGAAATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-303s1c1
Sequence:CCGGCCAGTTCTATGTGTTGATTTGCTCGAGCAAATCAACACATAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.1-551s1c1
Sequence:CCGGCACAATCTTCTGCACCGACAACTCGAGTTGTCGGTGCAGAAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-565s1c1
Sequence:CCGGCCGACAAATCCATAGACAGAACTCGAGTTCTGTCTATGGATTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-177s1c1
Sequence:CCGGCACAGGAACACCTTGAATGATCTCGAGATCATTCAAGGTGTTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-141s1c1
Sequence:CCGGGCCTTGATGGTGTACTTTCATCTCGAGATGAAAGTACACCATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-242s1c1
Sequence:CCGGGTCACAGATCGGGATGATATTCTCGAGAATATCATCCCGATCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027031
EFCAB9 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-417s1c1
Sequence:CCGGGAATATAGGTGCGGCCAATTTCTCGAGAAATTGGCCGCACCTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-535s1c1
Sequence:CCGGGAATTTAAGCTGTACACAATCCTCGAGGATTGTGTACAGCTTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-444s1c1
Sequence:CCGGCTACAGATTTCTCTTCAATATCTCGAGATATTGAAGAGAAATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.2-303s1c1
Sequence:CCGGCCAGTTCTATGTGTTGATTTGCTCGAGCAAATCAACACATAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027031.1-551s1c1
Sequence:CCGGCACAATCTTCTGCACCGACAACTCGAGTTGTCGGTGCAGAAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-565s1c1
Sequence:CCGGCCGACAAATCCATAGACAGAACTCGAGTTCTGTCTATGGATTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-177s1c1
Sequence:CCGGCACAGGAACACCTTGAATGATCTCGAGATCATTCAAGGTGTTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-141s1c1
Sequence:CCGGGCCTTGATGGTGTACTTTCATCTCGAGATGAAAGTACACCATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027031.1-242s1c1
Sequence:CCGGGTCACAGATCGGGATGATATTCTCGAGAATATCATCCCGATCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks