EMAIL THIS PAGE TO A FRIEND

EFCC1

EF-hand and coiled-coil domain containing 1

78 Gene Product Result for
Synonyms: C3orf73 CCDC48
UniProtKB ID: Q9HA90, A8MYE2
Gene ID:
Mouse(58229) EF hand and coiled-coil domain containing 1
Rat(685202) EF-hand and coiled-coil domain containing 1
naked mole-rat(101698024) EF-hand and coiled-coil domain containing 1
domestic guinea pig(100715366) EF-hand and coiled-coil domain containing 1
cow(617677) coiled-coil domain containing 48
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024768 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU181451 MISSION® esiRNA esiRNA targeting mouse Ccdc48 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024768 Rosetta Predictions human pricing
XM_001062782 Rosetta Predictions rat pricing
NM_021418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182678 predicted 1051
2 SASI_Hs02_00357274 predicted 1339
3 SASI_Hs01_00182679 predicted 1149
4 SASI_Hs01_00182680 predicted 1295
5 SASI_Hs01_00182681 predicted 897
6 SASI_Hs01_00182682 predicted 1306
7 SASI_Hs01_00182683 predicted 1103
8 SASI_Hs01_00182685 predicted 1151
9 SASI_Hs02_00357275 predicted 1088
10 SASI_Hs01_00182687 predicted 945
11 SASI_Hs01_00182684 predicted 1289
12 SASI_Hs01_00182686 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304573 predicted 363
2 SASI_Rn02_00304574 predicted 194
3 SASI_Rn02_00304575 predicted 233
4 SASI_Rn02_00304576 predicted 360
5 SASI_Rn02_00304577 predicted 360
6 SASI_Rn02_00304578 predicted 226
7 SASI_Rn02_00304579 predicted 329
8 SASI_Rn02_00304580 predicted 304
9 SASI_Rn02_00304581 predicted 198
10 SASI_Rn02_00304582 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326052 predicted 1327
2 SASI_Mm01_00159691 predicted 1404
3 SASI_Mm01_00159693 predicted 1395
4 SASI_Mm01_00159694 predicted 1314
5 SASI_Mm02_00326053 predicted 1271
6 SASI_Mm02_00326054 predicted 1412
7 SASI_Mm01_00159697 predicted 1235
8 SASI_Mm01_00159692 predicted 1340
9 SASI_Mm02_00326055 predicted 1146
10 SASI_Mm02_00326056 predicted 919
11 SASI_Mm01_00159695 predicted 1302
12 SASI_Mm01_00159696 predicted 1320
13 SASI_Mm01_00159698 predicted 1366
14 SASI_Mm01_00159699 predicted 1315
15 SASI_Mm01_00159700 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021418
EFCC1 MISSION shRNA Bacterial Glycerol Stock
EF-hand and coiled-coil domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021418.1-917s1c1
Sequence:CCGGCAGAGCTTAGAGGTTACAGGTCTCGAGACCTGTAACCTCTAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-914s21c1
Sequence:CCGGAGGCAGAGCTTAGAGGTTACACTCGAGTGTAACCTCTAAGCTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-476s21c1
Sequence:CCGGTTAGCGAGCACATCGAGACACCTCGAGGTGTCTCGATGTGCTCGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021418.2-1019s21c1
Sequence:CCGGATCCACGCTACGCACTCTAATCTCGAGATTAGAGTGCGTAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-422s21c1
Sequence:CCGGGCCTCTGCGGCTATTTCAGTACTCGAGTACTGAAATAGCCGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-146s21c1
Sequence:CCGGCTACCGGTCTGGATCAGTATCCTCGAGGATACTGATCCAGACCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021418
EFCC1 MISSION shRNA shRNA Plasmid DNA
EF-hand and coiled-coil domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021418.1-917s1c1
Sequence:CCGGCAGAGCTTAGAGGTTACAGGTCTCGAGACCTGTAACCTCTAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-914s21c1
Sequence:CCGGAGGCAGAGCTTAGAGGTTACACTCGAGTGTAACCTCTAAGCTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-476s21c1
Sequence:CCGGTTAGCGAGCACATCGAGACACCTCGAGGTGTCTCGATGTGCTCGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021418.2-1019s21c1
Sequence:CCGGATCCACGCTACGCACTCTAATCTCGAGATTAGAGTGCGTAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-422s21c1
Sequence:CCGGGCCTCTGCGGCTATTTCAGTACTCGAGTACTGAAATAGCCGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-146s21c1
Sequence:CCGGCTACCGGTCTGGATCAGTATCCTCGAGGATACTGATCCAGACCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021418
EFCC1 MISSION shRNA Lentiviral Transduction Particles
EF-hand and coiled-coil domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021418.1-917s1c1
Sequence:CCGGCAGAGCTTAGAGGTTACAGGTCTCGAGACCTGTAACCTCTAAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-914s21c1
Sequence:CCGGAGGCAGAGCTTAGAGGTTACACTCGAGTGTAACCTCTAAGCTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-476s21c1
Sequence:CCGGTTAGCGAGCACATCGAGACACCTCGAGGTGTCTCGATGTGCTCGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021418.2-1019s21c1
Sequence:CCGGATCCACGCTACGCACTCTAATCTCGAGATTAGAGTGCGTAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-422s21c1
Sequence:CCGGGCCTCTGCGGCTATTTCAGTACTCGAGTACTGAAATAGCCGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021418.2-146s21c1
Sequence:CCGGCTACCGGTCTGGATCAGTATCCTCGAGGATACTGATCCAGACCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024768
EFCC1 MISSION shRNA Bacterial Glycerol Stock
EF-hand and coiled-coil domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1765s1c1
Sequence:CCGGCTGCTCCTGAACACGCATTAACTCGAGTTAATGCGTGTTCAGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1511s1c1
Sequence:CCGGCTTTGGGATACCTGGTCTGTACTCGAGTACAGACCAGGTATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-736s1c1
Sequence:CCGGCAGAAGGTGGAAGAGAATGAGCTCGAGCTCATTCTCTTCCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1302s1c1
Sequence:CCGGGCCACCAGAGTCCACATTAAACTCGAGTTTAATGTGGACTCTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1651s1c1
Sequence:CCGGCAGGTAGGATTTAGACAGGTACTCGAGTACCTGTCTAAATCCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1553s1c1
Sequence:CCGGGAAATGTTGATGACTAGGAAACTCGAGTTTCCTAGTCATCAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-733s1c1
Sequence:CCGGCAGCAGAAGGTGGAAGAGAATCTCGAGATTCTCTTCCACCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-738s1c1
Sequence:CCGGGAAGGTGGAAGAGAATGAGCACTCGAGTGCTCATTCTCTTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1313s1c1
Sequence:CCGGCCACATTAAAGCCCTGCAGTTCTCGAGAACTGCAGGGCTTTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-735s1c1
Sequence:CCGGGCAGAAGGTGGAAGAGAATGACTCGAGTCATTCTCTTCCACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024768
EFCC1 MISSION shRNA shRNA Plasmid DNA
EF-hand and coiled-coil domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1765s1c1
Sequence:CCGGCTGCTCCTGAACACGCATTAACTCGAGTTAATGCGTGTTCAGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1511s1c1
Sequence:CCGGCTTTGGGATACCTGGTCTGTACTCGAGTACAGACCAGGTATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-736s1c1
Sequence:CCGGCAGAAGGTGGAAGAGAATGAGCTCGAGCTCATTCTCTTCCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1302s1c1
Sequence:CCGGGCCACCAGAGTCCACATTAAACTCGAGTTTAATGTGGACTCTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1651s1c1
Sequence:CCGGCAGGTAGGATTTAGACAGGTACTCGAGTACCTGTCTAAATCCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1553s1c1
Sequence:CCGGGAAATGTTGATGACTAGGAAACTCGAGTTTCCTAGTCATCAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-733s1c1
Sequence:CCGGCAGCAGAAGGTGGAAGAGAATCTCGAGATTCTCTTCCACCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-738s1c1
Sequence:CCGGGAAGGTGGAAGAGAATGAGCACTCGAGTGCTCATTCTCTTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1313s1c1
Sequence:CCGGCCACATTAAAGCCCTGCAGTTCTCGAGAACTGCAGGGCTTTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-735s1c1
Sequence:CCGGGCAGAAGGTGGAAGAGAATGACTCGAGTCATTCTCTTCCACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024768
EFCC1 MISSION shRNA Lentiviral Transduction Particles
EF-hand and coiled-coil domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1765s1c1
Sequence:CCGGCTGCTCCTGAACACGCATTAACTCGAGTTAATGCGTGTTCAGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1511s1c1
Sequence:CCGGCTTTGGGATACCTGGTCTGTACTCGAGTACAGACCAGGTATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-736s1c1
Sequence:CCGGCAGAAGGTGGAAGAGAATGAGCTCGAGCTCATTCTCTTCCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1302s1c1
Sequence:CCGGGCCACCAGAGTCCACATTAAACTCGAGTTTAATGTGGACTCTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1651s1c1
Sequence:CCGGCAGGTAGGATTTAGACAGGTACTCGAGTACCTGTCTAAATCCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1553s1c1
Sequence:CCGGGAAATGTTGATGACTAGGAAACTCGAGTTTCCTAGTCATCAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-733s1c1
Sequence:CCGGCAGCAGAAGGTGGAAGAGAATCTCGAGATTCTCTTCCACCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-738s1c1
Sequence:CCGGGAAGGTGGAAGAGAATGAGCACTCGAGTGCTCATTCTCTTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024768.1-1313s1c1
Sequence:CCGGCCACATTAAAGCCCTGCAGTTCTCGAGAACTGCAGGGCTTTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024768.1-735s1c1
Sequence:CCGGGCAGAAGGTGGAAGAGAATGACTCGAGTCATTCTCTTCCACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks