EMAIL THIS PAGE TO A FRIEND

EFEMP1

EGF containing fibulin-like extracellular matrix protein 1

146 Gene Product Result for
Synonyms: DHRD DRAD FBLN3 FBNL FIBL-3 MLVT MTLV S1-5
UniProtKB ID: Q12805, A8K3I4, D6W5D2, Q541U7
Gene ID:
Human(2202) Summary: This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
Mouse(216616) epidermal growth factor-containing fibulin-like extracellular matrix protein 1
Rat(305604) EGF-containing fibulin-like extracellular matrix protein 1
chicken(428543) EGF containing fibulin-like extracellular matrix protein 1
domestic cat(101094585) EGF containing fibulin-like extracellular matrix protein 1
dog(474604) EGF containing fibulin-like extracellular matrix protein 1
cow(511566) EGF containing fibulin-like extracellular matrix protein 1
domestic guinea pig(100713549) EGF containing fibulin-like extracellular matrix protein 1
naked mole-rat(101705517) EGF containing fibulin-like extracellular matrix protein 1
sheep(101120648) EGF containing fibulin-like extracellular matrix protein 1
Domestic Rabbit(100345739) EGF containing fibulin-like extracellular matrix protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039348 Rosetta Predictions human pricing
NM_001039349 Rosetta Predictions human pricing
NM_004105 Rosetta Predictions human pricing
NM_001012039 Rosetta Predictions rat pricing
XM_573678 Rosetta Predictions rat pricing
NM_146015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086980 predicted 1383
2 SASI_Hs01_00086981 predicted 1363
3 SASI_Hs01_00086982 predicted 1432
4 SASI_Hs01_00086983 predicted 1030
5 SASI_Hs02_00308453 predicted 1569
6 SASI_Hs02_00308454 predicted 818
7 SASI_Hs02_00308455 predicted 1221
8 SASI_Hs01_00086986 predicted 1471
9 SASI_Hs02_00308456 predicted 1576
10 SASI_Hs01_00086987 predicted 1357
11 SASI_Hs01_00086984 predicted 368
12 SASI_Hs01_00086985 predicted 827
13 SASI_Hs01_00086988 predicted 883
14 SASI_Hs01_00086989 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133234 predicted 1337
2 SASI_Hs01_00133235 predicted 1321
3 SASI_Hs01_00133236 predicted 1394
4 SASI_Hs01_00133237 predicted 992
5 SASI_Hs02_00308457 predicted 1526
6 SASI_Hs02_00308458 predicted 772
7 SASI_Hs02_00308459 predicted 1181
8 SASI_Hs01_00133240 predicted 1432
9 SASI_Hs02_00308460 predicted 1528
10 SASI_Hs01_00133241 predicted 1307
11 SASI_Hs01_00133238 predicted 320
12 SASI_Hs01_00133239 predicted 786
13 SASI_Hs01_00133242 predicted 836
14 SASI_Hs01_00133243 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098697 predicted 1571
2 SASI_Hs01_00098698 predicted 1558
3 SASI_Hs01_00098699 predicted 1627
4 SASI_Hs01_00098700 predicted 1228
5 SASI_Hs02_00336922 predicted 1767
6 SASI_Hs02_00336923 predicted 1007
7 SASI_Hs02_00336924 predicted 1418
8 SASI_Hs01_00098703 predicted 1664
9 SASI_Hs02_00336925 predicted 1769
10 SASI_Hs01_00098704 predicted 1550
11 SASI_Hs01_00098701 predicted 561
12 SASI_Hs01_00098702 predicted 1014
13 SASI_Hs01_00098705 predicted 1073
14 SASI_Hs01_00098706 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200138 predicted 1348
2 SASI_Rn01_00059936 predicted 946
3 SASI_Rn01_00059937 predicted 212
4 SASI_Rn01_00059938 predicted 1405
5 SASI_Rn01_00059939 predicted 1345
6 SASI_Rn01_00059940 predicted 1330
7 SASI_Rn01_00059941 predicted 1545
8 SASI_Rn01_00059942 predicted 1193
9 SASI_Rn01_00059943 predicted 489
10 SASI_Rn01_00059944 predicted 1665
11 SASI_Rn01_00059935 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161634 predicted 1141
2 SASI_Rn01_00161635 predicted 1289
3 SASI_Rn01_00161636 predicted 880
4 SASI_Rn01_00161637 predicted 1070
5 SASI_Rn01_00161638 predicted 1279
6 SASI_Rn01_00161639 predicted 1281
7 SASI_Rn01_00161640 predicted 1272
8 SASI_Rn01_00161641 predicted 1133
9 SASI_Rn01_00161642 predicted 417
10 SASI_Rn01_00161643 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180346 predicted 1686
2 SASI_Mm01_00180347 predicted 1426
3 SASI_Mm01_00180350 predicted 953
4 SASI_Mm02_00341568 predicted 265
5 SASI_Mm01_00180351 predicted 1369
6 SASI_Mm01_00180352 predicted 1561
7 SASI_Mm01_00180353 predicted 1355
8 SASI_Mm01_00180354 predicted 1703
9 SASI_Mm02_00341569 predicted 514
10 SASI_Mm02_00341570 predicted 746
11 SASI_Mm01_00180345 predicted 241
12 SASI_Mm01_00180348 predicted 1244
13 SASI_Mm01_00180349 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146015
VALIDATED
EFEMP1 MISSION shRNA Bacterial Glycerol Stock
EGF containing fibulin-like extracellular matrix protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1565s21c1
Sequence:CCGGGCTCTGTGTTAAGATTGACAACTCGAGTTGTCAATCTTAACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1873s21c1
Sequence:CCGGGCAAGGATACTGTTCTGTGTTCTCGAGAACACAGAACAGTATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-876s21c1
Sequence:CCGGCTACACTTGTGTGGATATAAACTCGAGTTTATATCCACACAAGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1115s21c1
Sequence:CCGGGCAGAACCTGTCAGGATATAACTCGAGTTATATCCTGACAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-1494s1c1
Sequence:CCGGGCAAGGATACTGTTCTGTGTTCTCGAGAACACAGAACAGTATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-307s1c1
Sequence:CCGGCGGACCAAGTATGCATCAATTCTCGAGAATTGATGCATACTTGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146015.1-663s1c1
Sequence:CCGGTGCCAATATCAATGTGTCAATCTCGAGATTGACACATTGATATTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-736s1c1
Sequence:CCGGGCAGAACCTGTCAGGATATAACTCGAGTTATATCCTGACAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-1186s1c1
Sequence:CCGGGCTCTGTGTTAAGATTGACAACTCGAGTTGTCAATCTTAACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146015
VALIDATED
EFEMP1 MISSION shRNA shRNA Plasmid DNA
EGF containing fibulin-like extracellular matrix protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1565s21c1
Sequence:CCGGGCTCTGTGTTAAGATTGACAACTCGAGTTGTCAATCTTAACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1873s21c1
Sequence:CCGGGCAAGGATACTGTTCTGTGTTCTCGAGAACACAGAACAGTATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-876s21c1
Sequence:CCGGCTACACTTGTGTGGATATAAACTCGAGTTTATATCCACACAAGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1115s21c1
Sequence:CCGGGCAGAACCTGTCAGGATATAACTCGAGTTATATCCTGACAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-1494s1c1
Sequence:CCGGGCAAGGATACTGTTCTGTGTTCTCGAGAACACAGAACAGTATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-307s1c1
Sequence:CCGGCGGACCAAGTATGCATCAATTCTCGAGAATTGATGCATACTTGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146015.1-663s1c1
Sequence:CCGGTGCCAATATCAATGTGTCAATCTCGAGATTGACACATTGATATTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-736s1c1
Sequence:CCGGGCAGAACCTGTCAGGATATAACTCGAGTTATATCCTGACAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-1186s1c1
Sequence:CCGGGCTCTGTGTTAAGATTGACAACTCGAGTTGTCAATCTTAACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146015
VALIDATED
EFEMP1 MISSION shRNA Lentiviral Transduction Particles
EGF containing fibulin-like extracellular matrix protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1565s21c1
Sequence:CCGGGCTCTGTGTTAAGATTGACAACTCGAGTTGTCAATCTTAACACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1873s21c1
Sequence:CCGGGCAAGGATACTGTTCTGTGTTCTCGAGAACACAGAACAGTATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-876s21c1
Sequence:CCGGCTACACTTGTGTGGATATAAACTCGAGTTTATATCCACACAAGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146015.2-1115s21c1
Sequence:CCGGGCAGAACCTGTCAGGATATAACTCGAGTTATATCCTGACAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-1494s1c1
Sequence:CCGGGCAAGGATACTGTTCTGTGTTCTCGAGAACACAGAACAGTATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-307s1c1
Sequence:CCGGCGGACCAAGTATGCATCAATTCTCGAGAATTGATGCATACTTGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146015.1-663s1c1
Sequence:CCGGTGCCAATATCAATGTGTCAATCTCGAGATTGACACATTGATATTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-736s1c1
Sequence:CCGGGCAGAACCTGTCAGGATATAACTCGAGTTATATCCTGACAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146015.1-1186s1c1
Sequence:CCGGGCTCTGTGTTAAGATTGACAACTCGAGTTGTCAATCTTAACACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004105
VALIDATED
EFEMP1 MISSION shRNA Bacterial Glycerol Stock
EGF containing fibulin-like extracellular matrix protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-439s21c1
Sequence:CCGGCCTGTGAGACAGCAATGCAAACTCGAGTTTGCATTGCTGTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-965s21c1
Sequence:CCGGGCGTAGACATAGATGAATGTACTCGAGTACATTCATCTATGTCTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-553s21c1
Sequence:CCGGGCCCAGATTATTGTCAATAATCTCGAGATTATTGACAATAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-1500s21c1
Sequence:CCGGCCAGTCAATAGTCTACAAATACTCGAGTATTTGTAGACTATTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004105.2-372s1c1
Sequence:CCGGGCCCAGATTATTGTCAATAATCTCGAGATTATTGACAATAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-784s1c1
Sequence:CCGGGCGTAGACATAGATGAATGTACTCGAGTACATTCATCTATGTCTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-258s1c1
Sequence:CCGGCCTGTGAGACAGCAATGCAAACTCGAGTTTGCATTGCTGTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-1319s1c1
Sequence:CCGGCCAGTCAATAGTCTACAAATACTCGAGTATTTGTAGACTATTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004105.2-820s1c1
Sequence:CCGGGCCACCAAAGATGCGTGAATACTCGAGTATTCACGCATCTTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004105
VALIDATED
EFEMP1 MISSION shRNA shRNA Plasmid DNA
EGF containing fibulin-like extracellular matrix protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-439s21c1
Sequence:CCGGCCTGTGAGACAGCAATGCAAACTCGAGTTTGCATTGCTGTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-965s21c1
Sequence:CCGGGCGTAGACATAGATGAATGTACTCGAGTACATTCATCTATGTCTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-553s21c1
Sequence:CCGGGCCCAGATTATTGTCAATAATCTCGAGATTATTGACAATAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-1500s21c1
Sequence:CCGGCCAGTCAATAGTCTACAAATACTCGAGTATTTGTAGACTATTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004105.2-372s1c1
Sequence:CCGGGCCCAGATTATTGTCAATAATCTCGAGATTATTGACAATAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-784s1c1
Sequence:CCGGGCGTAGACATAGATGAATGTACTCGAGTACATTCATCTATGTCTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-258s1c1
Sequence:CCGGCCTGTGAGACAGCAATGCAAACTCGAGTTTGCATTGCTGTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-1319s1c1
Sequence:CCGGCCAGTCAATAGTCTACAAATACTCGAGTATTTGTAGACTATTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004105.2-820s1c1
Sequence:CCGGGCCACCAAAGATGCGTGAATACTCGAGTATTCACGCATCTTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004105
VALIDATED
EFEMP1 MISSION shRNA Lentiviral Transduction Particles
EGF containing fibulin-like extracellular matrix protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-439s21c1
Sequence:CCGGCCTGTGAGACAGCAATGCAAACTCGAGTTTGCATTGCTGTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-965s21c1
Sequence:CCGGGCGTAGACATAGATGAATGTACTCGAGTACATTCATCTATGTCTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-553s21c1
Sequence:CCGGGCCCAGATTATTGTCAATAATCTCGAGATTATTGACAATAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004105.3-1500s21c1
Sequence:CCGGCCAGTCAATAGTCTACAAATACTCGAGTATTTGTAGACTATTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004105.2-372s1c1
Sequence:CCGGGCCCAGATTATTGTCAATAATCTCGAGATTATTGACAATAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-784s1c1
Sequence:CCGGGCGTAGACATAGATGAATGTACTCGAGTACATTCATCTATGTCTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-258s1c1
Sequence:CCGGCCTGTGAGACAGCAATGCAAACTCGAGTTTGCATTGCTGTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004105.2-1319s1c1
Sequence:CCGGCCAGTCAATAGTCTACAAATACTCGAGTATTTGTAGACTATTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004105.2-820s1c1
Sequence:CCGGGCCACCAAAGATGCGTGAATACTCGAGTATTCACGCATCTTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)