EMAIL THIS PAGE TO A FRIEND

EFEMP2

EGF containing fibulin-like extracellular matrix protein 2

62 Gene Product Result for
Synonyms: ARCL1B FBLN4 MBP1 UPH1
UniProtKB ID: O95967, A8K7R4, B3KM31, B3KQT1, O75967
Gene ID:
Human(30008) Summary: A large number of extracellular matrix proteins have been found to contain variations of the epidermal growth factor (EGF) domain and have been implicated in functions as diverse as blood coagulation, activation of complement and determination of cell fate during development. The protein encoded by this gene contains four EGF2 domains and six calcium-binding EGF2 domains. This gene is necessary for elastic fiber formation and connective tissue development. Defects in this gene are cause of an autosomal recessive cutis laxa syndrome. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
Mouse(58859) epidermal growth factor-containing fibulin-like extracellular matrix protein 2
Rat(293677) EGF-containing fibulin-like extracellular matrix protein 2
sheep(101103198) EGF containing fibulin-like extracellular matrix protein 2
naked mole-rat(101711423) EGF containing fibulin-like extracellular matrix protein 2
domestic guinea pig(100733120) EGF containing fibulin-like extracellular matrix protein 2
dog(476020) EGF containing fibulin-like extracellular matrix protein 2
cow(535222) EGF containing fibulin-like extracellular matrix protein 2
Horse(100057642) EGF containing fibulin-like extracellular matrix protein 2
domestic cat(101097593) EGF containing fibulin-like extracellular matrix protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016938 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016938 Rosetta Predictions human pricing
NM_001005907 Rosetta Predictions rat pricing
XM_001070338 Rosetta Predictions rat pricing
NM_021474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208624 predicted 228
2 SASI_Hs01_00208625 predicted 1078
3 SASI_Hs01_00208626 predicted 594
4 SASI_Hs01_00208627 predicted 1349
5 SASI_Hs02_00349933 predicted 1371
6 SASI_Hs01_00208628 predicted 1400
7 SASI_Hs01_00208629 predicted 461
8 SASI_Hs01_00208630 predicted 1143
9 SASI_Hs01_00208631 predicted 1234
10 SASI_Hs01_00208632 predicted 877
11 SASI_Hs01_00208633 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106317 predicted 556
2 SASI_Rn01_00106318 predicted 671
3 SASI_Rn01_00106320 predicted 851
4 SASI_Rn01_00106321 predicted 230
5 SASI_Rn01_00106322 predicted 933
6 SASI_Rn01_00106323 predicted 1041
7 SASI_Rn01_00106324 predicted 663
8 SASI_Rn01_00106325 predicted 800
9 SASI_Rn01_00106326 predicted 389
10 SASI_Rn02_00198494 predicted 757
11 SASI_Rn01_00106319 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331308 predicted 503
2 SASI_Rn02_00331309 predicted 1355
3 SASI_Rn02_00331310 predicted 211
4 SASI_Rn02_00331311 predicted 1042
5 SASI_Rn02_00331312 predicted 762
6 SASI_Rn02_00331313 predicted 247
7 SASI_Rn02_00331314 predicted 284
8 SASI_Rn02_00331315 predicted 1117
9 SASI_Rn02_00331316 predicted 1233
10 SASI_Rn02_00331317 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188989 predicted 801
2 SASI_Mm01_00188990 predicted 1460
3 SASI_Mm01_00188991 predicted 779
4 SASI_Mm01_00188992 predicted 1327
5 SASI_Mm01_00188993 predicted 1412
6 SASI_Mm01_00188994 predicted 988
7 SASI_Mm01_00188995 predicted 427
8 SASI_Mm01_00188996 predicted 815
9 SASI_Mm01_00188997 predicted 786
10 SASI_Mm01_00188998 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021474
VALIDATED
EFEMP2 MISSION shRNA Bacterial Glycerol Stock
EGF containing fibulin-like extracellular matrix protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-784s1c1
Sequence:CCGGCCCGAATGTGTGGACATAGATCTCGAGATCTATGTCCACACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-562s1c1
Sequence:CCGGGCCGTCATCAATGATCTCCATCTCGAGATGGAGATCATTGATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1464s1c1
Sequence:CCGGCTTCTACATTAGGCAAATCAACTCGAGTTGATTTGCCTAATGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1419s1c1
Sequence:CCGGTGCCTACAATGCCTTTCAGATCTCGAGATCTGAAAGGCATTGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1597s1c1
Sequence:CCGGGTACTGAGACTCACGGTCTTTCTCGAGAAAGACCGTGAGTCTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1464s21c1
Sequence:CCGGCTTCTACATTAGGCAAATCAACTCGAGTTGATTTGCCTAATGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1419s21c1
Sequence:CCGGTGCCTACAATGCCTTTCAGATCTCGAGATCTGAAAGGCATTGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-784s21c1
Sequence:CCGGCCCGAATGTGTGGACATAGATCTCGAGATCTATGTCCACACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1597s21c1
Sequence:CCGGGTACTGAGACTCACGGTCTTTCTCGAGAAAGACCGTGAGTCTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021474
VALIDATED
EFEMP2 MISSION shRNA shRNA Plasmid DNA
EGF containing fibulin-like extracellular matrix protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-784s1c1
Sequence:CCGGCCCGAATGTGTGGACATAGATCTCGAGATCTATGTCCACACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-562s1c1
Sequence:CCGGGCCGTCATCAATGATCTCCATCTCGAGATGGAGATCATTGATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1464s1c1
Sequence:CCGGCTTCTACATTAGGCAAATCAACTCGAGTTGATTTGCCTAATGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1419s1c1
Sequence:CCGGTGCCTACAATGCCTTTCAGATCTCGAGATCTGAAAGGCATTGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1597s1c1
Sequence:CCGGGTACTGAGACTCACGGTCTTTCTCGAGAAAGACCGTGAGTCTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1464s21c1
Sequence:CCGGCTTCTACATTAGGCAAATCAACTCGAGTTGATTTGCCTAATGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1419s21c1
Sequence:CCGGTGCCTACAATGCCTTTCAGATCTCGAGATCTGAAAGGCATTGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-784s21c1
Sequence:CCGGCCCGAATGTGTGGACATAGATCTCGAGATCTATGTCCACACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1597s21c1
Sequence:CCGGGTACTGAGACTCACGGTCTTTCTCGAGAAAGACCGTGAGTCTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021474
VALIDATED
EFEMP2 MISSION shRNA Lentiviral Transduction Particles
EGF containing fibulin-like extracellular matrix protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-784s1c1
Sequence:CCGGCCCGAATGTGTGGACATAGATCTCGAGATCTATGTCCACACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-562s1c1
Sequence:CCGGGCCGTCATCAATGATCTCCATCTCGAGATGGAGATCATTGATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1464s1c1
Sequence:CCGGCTTCTACATTAGGCAAATCAACTCGAGTTGATTTGCCTAATGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1419s1c1
Sequence:CCGGTGCCTACAATGCCTTTCAGATCTCGAGATCTGAAAGGCATTGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021474.2-1597s1c1
Sequence:CCGGGTACTGAGACTCACGGTCTTTCTCGAGAAAGACCGTGAGTCTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1464s21c1
Sequence:CCGGCTTCTACATTAGGCAAATCAACTCGAGTTGATTTGCCTAATGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1419s21c1
Sequence:CCGGTGCCTACAATGCCTTTCAGATCTCGAGATCTGAAAGGCATTGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-784s21c1
Sequence:CCGGCCCGAATGTGTGGACATAGATCTCGAGATCTATGTCCACACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021474.2-1597s21c1
Sequence:CCGGGTACTGAGACTCACGGTCTTTCTCGAGAAAGACCGTGAGTCTCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016938
EFEMP2 MISSION shRNA Bacterial Glycerol Stock
EGF containing fibulin-like extracellular matrix protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-540s1c1
Sequence:CCGGCCCTGATGGTTACCGCAAGATCTCGAGATCTTGCGGTAACCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-738s1c1
Sequence:CCGGCTTCAACTCCTATGGGACCTTCTCGAGAAGGTCCCATAGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-340s1c1
Sequence:CCGGGCTGCCGTCATCAACGACCTACTCGAGTAGGTCGTTGATGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-1195s1c1
Sequence:CCGGCCCGGTGCCTACAATGCCTTTCTCGAGAAAGGCATTGTAGGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016938.3-1486s21c1
Sequence:CCGGTACTGAGGCTCACCGTCTTTGCTCGAGCAAAGACGGTGAGCCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016938.3-907s21c1
Sequence:CCGGGCTTCTCCTGCAGTGATATTGCTCGAGCAATATCACTGCAGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016938.3-1691s21c1
Sequence:CCGGGCAGGCCAAGTTCACCTAAATCTCGAGATTTAGGTGAACTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016938
EFEMP2 MISSION shRNA shRNA Plasmid DNA
EGF containing fibulin-like extracellular matrix protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-540s1c1
Sequence:CCGGCCCTGATGGTTACCGCAAGATCTCGAGATCTTGCGGTAACCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-738s1c1
Sequence:CCGGCTTCAACTCCTATGGGACCTTCTCGAGAAGGTCCCATAGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-340s1c1
Sequence:CCGGGCTGCCGTCATCAACGACCTACTCGAGTAGGTCGTTGATGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-1195s1c1
Sequence:CCGGCCCGGTGCCTACAATGCCTTTCTCGAGAAAGGCATTGTAGGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016938.3-1486s21c1
Sequence:CCGGTACTGAGGCTCACCGTCTTTGCTCGAGCAAAGACGGTGAGCCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016938.3-907s21c1
Sequence:CCGGGCTTCTCCTGCAGTGATATTGCTCGAGCAATATCACTGCAGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016938.3-1691s21c1
Sequence:CCGGGCAGGCCAAGTTCACCTAAATCTCGAGATTTAGGTGAACTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016938
EFEMP2 MISSION shRNA Lentiviral Transduction Particles
EGF containing fibulin-like extracellular matrix protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-540s1c1
Sequence:CCGGCCCTGATGGTTACCGCAAGATCTCGAGATCTTGCGGTAACCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-738s1c1
Sequence:CCGGCTTCAACTCCTATGGGACCTTCTCGAGAAGGTCCCATAGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-340s1c1
Sequence:CCGGGCTGCCGTCATCAACGACCTACTCGAGTAGGTCGTTGATGACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016938.1-1195s1c1
Sequence:CCGGCCCGGTGCCTACAATGCCTTTCTCGAGAAAGGCATTGTAGGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016938.3-1486s21c1
Sequence:CCGGTACTGAGGCTCACCGTCTTTGCTCGAGCAAAGACGGTGAGCCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016938.3-907s21c1
Sequence:CCGGGCTTCTCCTGCAGTGATATTGCTCGAGCAATATCACTGCAGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016938.3-1691s21c1
Sequence:CCGGGCAGGCCAAGTTCACCTAAATCTCGAGATTTAGGTGAACTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks