EMAIL THIS PAGE TO A FRIEND

EFHB

EF-hand domain family, member B

UniProtKB ID: Q8N7U6, A6ND25, A8MPR3, Q6ZWK9, Q8IV58, Q96LQ6
Gene ID:
Mouse(211482) EF hand domain family, member B
Rat(301168) EF hand domain family, member B
Zebrafish(571184) EF-hand domain family, member B
chicken(428439) EF-hand domain family, member B
cow(530549) EF-hand domain family, member B
domestic cat(101101661) EF-hand domain family, member B
dog(485648) EF-hand domain family, member B
sheep(101120979) EF-hand domain family, member B
Domestic Rabbit(100345515) EF-hand domain family, member B
domestic guinea pig(100719844) EF-hand domain family, member B
naked mole-rat(101710299) EF-hand domain family, member B
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103494 Anti-EFHB (731-745) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1307154 ANTI-EFHB(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140861 MISSION® esiRNA esiRNA human EFHB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144715 Rosetta Predictions human pricing
NM_001106879 Rosetta Predictions rat pricing
NM_172497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210957 predicted 1042
2 SASI_Hs01_00210959 predicted 1507
3 SASI_Hs01_00210960 predicted 1966
4 SASI_Hs01_00210961 predicted 2611
5 SASI_Hs02_00364656 predicted 544
6 SASI_Hs01_00210962 predicted 1583
7 SASI_Hs01_00210963 predicted 2529
8 SASI_Hs01_00210964 predicted 2041
9 SASI_Hs01_00210965 predicted 1952
10 SASI_Hs02_00364657 predicted 1326
11 SASI_Hs01_00210956 predicted 1265
12 SASI_Hs01_00210958 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223306 predicted 1113
2 SASI_Rn02_00223307 predicted 1202
3 SASI_Rn02_00223308 predicted 1987
4 SASI_Rn02_00223309 predicted 1063
5 SASI_Rn02_00223310 predicted 905
6 SASI_Rn02_00223311 predicted 1457
7 SASI_Rn02_00223312 predicted 2167
8 SASI_Rn02_00223313 predicted 1958
9 SASI_Rn02_00223314 predicted 669
10 SASI_Rn02_00223315 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028383 predicted 1119
2 SASI_Mm01_00028384 predicted 1961
3 SASI_Mm02_00344081 predicted 696
4 SASI_Mm01_00028385 predicted 480
5 SASI_Mm01_00028386 predicted 2006
6 SASI_Mm01_00028387 predicted 1953
7 SASI_Mm01_00028389 predicted 356
8 SASI_Mm01_00028390 predicted 826
9 SASI_Mm01_00028391 predicted 1985
10 SASI_Mm02_00344082 predicted 2077
11 SASI_Mm01_00028382 predicted 2177
12 SASI_Mm01_00028388 predicted 1219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144715
VALIDATED
EFHB MISSION shRNA Bacterial Glycerol Stock
EF-hand domain family, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-2295s21c1
Sequence:CCGGCAACTTCTTCTGAGATCAATGCTCGAGCATTGATCTCAGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-1769s21c1
Sequence:CCGGGTTGGTGATCTCATCCATAATCTCGAGATTATGGATGAGATCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-2438s21c1
Sequence:CCGGAGTGCATATTCACTACTATATCTCGAGATATAGTAGTGAATATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-331s21c1
Sequence:CCGGGAGCCCTGTGGTTAGTAATAACTCGAGTTATTACTAACCACAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-1334s21c1
Sequence:CCGGGACACAACCAATACGACATTTCTCGAGAAATGTCGTATTGGTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_144715.2-2166s1c1
Sequence:CCGGGCCAGAAGATATTGTCTTAAACTCGAGTTTAAGACAATATCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-2368s1c1
Sequence:CCGGCGCATCAGTGACAGAACTAATCTCGAGATTAGTTCTGTCACTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144715.2-833s1c1
Sequence:CCGGCCCAACAACATGAACAGAGAACTCGAGTTCTCTGTTCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-2632s1c1
Sequence:CCGGGCAGACCGGATCAAGTGTAAACTCGAGTTTACACTTGATCCGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-1177s1c1
Sequence:CCGGCCACAGCCTATTACCACATTTCTCGAGAAATGTGGTAATAGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144715
VALIDATED
EFHB MISSION shRNA shRNA Plasmid DNA
EF-hand domain family, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-2295s21c1
Sequence:CCGGCAACTTCTTCTGAGATCAATGCTCGAGCATTGATCTCAGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-1769s21c1
Sequence:CCGGGTTGGTGATCTCATCCATAATCTCGAGATTATGGATGAGATCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-2438s21c1
Sequence:CCGGAGTGCATATTCACTACTATATCTCGAGATATAGTAGTGAATATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-331s21c1
Sequence:CCGGGAGCCCTGTGGTTAGTAATAACTCGAGTTATTACTAACCACAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-1334s21c1
Sequence:CCGGGACACAACCAATACGACATTTCTCGAGAAATGTCGTATTGGTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_144715.2-2166s1c1
Sequence:CCGGGCCAGAAGATATTGTCTTAAACTCGAGTTTAAGACAATATCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-2368s1c1
Sequence:CCGGCGCATCAGTGACAGAACTAATCTCGAGATTAGTTCTGTCACTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144715.2-833s1c1
Sequence:CCGGCCCAACAACATGAACAGAGAACTCGAGTTCTCTGTTCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-2632s1c1
Sequence:CCGGGCAGACCGGATCAAGTGTAAACTCGAGTTTACACTTGATCCGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-1177s1c1
Sequence:CCGGCCACAGCCTATTACCACATTTCTCGAGAAATGTGGTAATAGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144715
VALIDATED
EFHB MISSION shRNA Lentiviral Transduction Particles
EF-hand domain family, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-2295s21c1
Sequence:CCGGCAACTTCTTCTGAGATCAATGCTCGAGCATTGATCTCAGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-1769s21c1
Sequence:CCGGGTTGGTGATCTCATCCATAATCTCGAGATTATGGATGAGATCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-2438s21c1
Sequence:CCGGAGTGCATATTCACTACTATATCTCGAGATATAGTAGTGAATATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-331s21c1
Sequence:CCGGGAGCCCTGTGGTTAGTAATAACTCGAGTTATTACTAACCACAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144715.3-1334s21c1
Sequence:CCGGGACACAACCAATACGACATTTCTCGAGAAATGTCGTATTGGTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_144715.2-2166s1c1
Sequence:CCGGGCCAGAAGATATTGTCTTAAACTCGAGTTTAAGACAATATCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-2368s1c1
Sequence:CCGGCGCATCAGTGACAGAACTAATCTCGAGATTAGTTCTGTCACTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144715.2-833s1c1
Sequence:CCGGCCCAACAACATGAACAGAGAACTCGAGTTCTCTGTTCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-2632s1c1
Sequence:CCGGGCAGACCGGATCAAGTGTAAACTCGAGTTTACACTTGATCCGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144715.2-1177s1c1
Sequence:CCGGCCACAGCCTATTACCACATTTCTCGAGAAATGTGGTAATAGGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172497
EFHB MISSION shRNA Bacterial Glycerol Stock
EF-hand domain family, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-844s1c1
Sequence:CCGGGCCCATATACTCAGGGAAGTTCTCGAGAACTTCCCTGAGTATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-1676s1c1
Sequence:CCGGGCTGGCGATCTCATCCATTATCTCGAGATAATGGATGAGATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-131s1c1
Sequence:CCGGGCACCTGAAATCTCGGAACTTCTCGAGAAGTTCCGAGATTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-1454s1c1
Sequence:CCGGCCAACACCTCACTTTAATGATCTCGAGATCATTAAAGTGAGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-306s1c1
Sequence:CCGGCTCTTGGAGTAGGATTAGAAACTCGAGTTTCTAATCCTACTCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172497
EFHB MISSION shRNA shRNA Plasmid DNA
EF-hand domain family, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-844s1c1
Sequence:CCGGGCCCATATACTCAGGGAAGTTCTCGAGAACTTCCCTGAGTATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-1676s1c1
Sequence:CCGGGCTGGCGATCTCATCCATTATCTCGAGATAATGGATGAGATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-131s1c1
Sequence:CCGGGCACCTGAAATCTCGGAACTTCTCGAGAAGTTCCGAGATTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-1454s1c1
Sequence:CCGGCCAACACCTCACTTTAATGATCTCGAGATCATTAAAGTGAGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-306s1c1
Sequence:CCGGCTCTTGGAGTAGGATTAGAAACTCGAGTTTCTAATCCTACTCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172497
EFHB MISSION shRNA Lentiviral Transduction Particles
EF-hand domain family, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-844s1c1
Sequence:CCGGGCCCATATACTCAGGGAAGTTCTCGAGAACTTCCCTGAGTATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-1676s1c1
Sequence:CCGGGCTGGCGATCTCATCCATTATCTCGAGATAATGGATGAGATCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-131s1c1
Sequence:CCGGGCACCTGAAATCTCGGAACTTCTCGAGAAGTTCCGAGATTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-1454s1c1
Sequence:CCGGCCAACACCTCACTTTAATGATCTCGAGATCATTAAAGTGAGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172497.1-306s1c1
Sequence:CCGGCTCTTGGAGTAGGATTAGAAACTCGAGTTTCTAATCCTACTCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks