EMAIL THIS PAGE TO A FRIEND

EFHC1

EF-hand domain (C-terminal) containing 1

81 Gene Product Result for
Synonyms: dJ304B14.2
Gene ID:
Human(114327) Summary: This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Mouse(71877) EF-hand domain (C-terminal) containing 1
Rat(301295) EF-hand domain (C-terminal) containing 1
naked mole-rat(101717297) EF-hand domain (C-terminal) containing 1
domestic guinea pig(100736135) EF-hand domain (C-terminal) containing 1
sheep(101105193) EF-hand domain (C-terminal) containing 1
Domestic Rabbit(100352671) EF-hand domain (C-terminal) containing 1
Zebrafish(393942) EF-hand domain (C-terminal) containing 1
cow(510124) EF-hand domain (C-terminal) containing 1
Horse(100069174) EF-hand domain (C-terminal) containing 1
domestic cat(101084030) EF-hand domain (C-terminal) containing 1
dog(474935) EF-hand domain (C-terminal) containing 1
chicken(422041) EF-hand domain (C-terminal) containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018100 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018100 Rosetta Predictions human pricing
NM_001122947 Rosetta Predictions rat pricing
XM_129694 Rosetta Predictions mouse pricing
XM_897162 Rosetta Predictions mouse pricing
XM_907335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035486 predicted 318
2 SASI_Hs02_00351283 predicted 1941
3 SASI_Hs01_00035487 predicted 493
4 SASI_Hs01_00035489 predicted 403
5 SASI_Hs02_00351284 predicted 2100
6 SASI_Hs01_00035490 predicted 996
7 SASI_Hs01_00035492 predicted 1144
8 SASI_Hs01_00035494 predicted 1723
9 SASI_Hs02_00351285 predicted 2057
10 SASI_Hs01_00035495 predicted 1603
11 SASI_Hs01_00035488 predicted 1054
12 SASI_Hs01_00035491 predicted 1149
13 SASI_Hs01_00035493 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252713 predicted 1450
2 SASI_Rn02_00252714 predicted 1585
3 SASI_Rn02_00252715 predicted 530
4 SASI_Rn02_00252716 predicted 560
5 SASI_Rn02_00252717 predicted 1284
6 SASI_Rn02_00252718 predicted 1433
7 SASI_Rn02_00252719 predicted 609
8 SASI_Rn02_00252720 predicted 1403
9 SASI_Rn02_00252721 predicted 1076
10 SASI_Rn02_00252722 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424316 predicted 438
2 SASI_Mm02_00424317 predicted 551
3 SASI_Mm02_00424318 predicted 333
4 SASI_Mm02_00424319 predicted 415
5 SASI_Mm02_00424320 predicted 477
6 SASI_Mm02_00424321 predicted 566
7 SASI_Mm02_00424322 predicted 472
8 SASI_Mm02_00424323 predicted 483
9 SASI_Mm02_00424324 predicted 469
10 SASI_Mm02_00424325 predicted 441
11 SASI_Mm01_00207920 predicted 1198
12 SASI_Mm01_00207921 predicted 1459
13 SASI_Mm01_00207922 predicted 1809
14 SASI_Mm01_00207923 predicted 1766
15 SASI_Mm01_00207924 predicted 1568
16 SASI_Mm01_00207925 predicted 1879
17 SASI_Mm01_00207926 predicted 1382
18 SASI_Mm01_00207927 predicted 1391
19 SASI_Mm01_00207928 predicted 1752
20 SASI_Mm01_00207929 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221759 predicted 1156
2 SASI_Mm01_00221760 predicted 1258
3 SASI_Mm01_00221761 predicted 1549
4 SASI_Mm01_00221762 predicted 1508
5 SASI_Mm01_00221763 predicted 1463
6 SASI_Mm01_00221764 predicted 1264
7 SASI_Mm01_00221765 predicted 1473
8 SASI_Mm01_00221766 predicted 1600
9 SASI_Mm01_00221767 predicted 1317
10 SASI_Mm01_00221768 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433247 predicted 1454
2 SASI_Mm02_00433248 predicted 738
3 SASI_Mm02_00433249 predicted 555
4 SASI_Mm02_00433250 predicted 718
5 SASI_Mm02_00433251 predicted 237
6 SASI_Mm02_00433252 predicted 1761
7 SASI_Mm02_00433253 predicted 246
8 SASI_Mm02_00433254 predicted 1556
9 SASI_Mm02_00433255 predicted 1875
10 SASI_Mm02_00433256 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018100
EFHC1 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain (C-terminal) containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-1158s1c1
Sequence:CCGGCGGTATTACAAAGAGAAGTTTCTCGAGAAACTTCTCTTTGTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-1766s1c1
Sequence:CCGGCGTGCAGGAATTGGAAGCATTCTCGAGAATGCTTCCAATTCCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-453s1c1
Sequence:CCGGCGTCAGGTGAACATTTACTATCTCGAGATAGTAAATGTTCACCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-142s1c1
Sequence:CCGGGCACGTCCTTTAAGGACTCTACTCGAGTAGAGTCCTTAAAGGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-609s1c1
Sequence:CCGGCGAGGAATAAACATCACAATTCTCGAGAATTGTGATGTTTATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-1552s21c1
Sequence:CCGGCCGACATGATCAGTATCTTTGCTCGAGCAAAGATACTGATCATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-1463s21c1
Sequence:CCGGTAACAAGGTGCTTCGTTATTTCTCGAGAAATAACGAAGCACCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-774s21c1
Sequence:CCGGGACCAATTCACACAGGTATTTCTCGAGAAATACCTGTGTGAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018100
EFHC1 MISSION shRNA shRNA Plasmid DNA
EF-hand domain (C-terminal) containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-1158s1c1
Sequence:CCGGCGGTATTACAAAGAGAAGTTTCTCGAGAAACTTCTCTTTGTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-1766s1c1
Sequence:CCGGCGTGCAGGAATTGGAAGCATTCTCGAGAATGCTTCCAATTCCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-453s1c1
Sequence:CCGGCGTCAGGTGAACATTTACTATCTCGAGATAGTAAATGTTCACCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-142s1c1
Sequence:CCGGGCACGTCCTTTAAGGACTCTACTCGAGTAGAGTCCTTAAAGGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-609s1c1
Sequence:CCGGCGAGGAATAAACATCACAATTCTCGAGAATTGTGATGTTTATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-1552s21c1
Sequence:CCGGCCGACATGATCAGTATCTTTGCTCGAGCAAAGATACTGATCATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-1463s21c1
Sequence:CCGGTAACAAGGTGCTTCGTTATTTCTCGAGAAATAACGAAGCACCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-774s21c1
Sequence:CCGGGACCAATTCACACAGGTATTTCTCGAGAAATACCTGTGTGAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018100
EFHC1 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain (C-terminal) containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-1158s1c1
Sequence:CCGGCGGTATTACAAAGAGAAGTTTCTCGAGAAACTTCTCTTTGTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-1766s1c1
Sequence:CCGGCGTGCAGGAATTGGAAGCATTCTCGAGAATGCTTCCAATTCCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-453s1c1
Sequence:CCGGCGTCAGGTGAACATTTACTATCTCGAGATAGTAAATGTTCACCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-142s1c1
Sequence:CCGGGCACGTCCTTTAAGGACTCTACTCGAGTAGAGTCCTTAAAGGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018100.1-609s1c1
Sequence:CCGGCGAGGAATAAACATCACAATTCTCGAGAATTGTGATGTTTATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-1552s21c1
Sequence:CCGGCCGACATGATCAGTATCTTTGCTCGAGCAAAGATACTGATCATGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-1463s21c1
Sequence:CCGGTAACAAGGTGCTTCGTTATTTCTCGAGAAATAACGAAGCACCTTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018100.3-774s21c1
Sequence:CCGGGACCAATTCACACAGGTATTTCTCGAGAAATACCTGTGTGAATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129694
EFHC1 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain (C-terminal) containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-472s1c1
Sequence:CCGGCCCATATCAATGGAGGAGCATCTCGAGATGCTCCTCCATTGATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1553s1c1
Sequence:CCGGGCAGGACTAAAGTTGTTAAATCTCGAGATTTAACAACTTTAGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1908s1c1
Sequence:CCGGCCTCCGTGAAACATTTCAAATCTCGAGATTTGAAATGTTTCACGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1881s1c1
Sequence:CCGGCCTGAAATACAATTCATGCAACTCGAGTTGCATGAATTGTATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-451s1c1
Sequence:CCGGGCCTACTTCCAAGAAGATGTTCTCGAGAACATCTTCTTGGAAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129694
EFHC1 MISSION shRNA shRNA Plasmid DNA
EF-hand domain (C-terminal) containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-472s1c1
Sequence:CCGGCCCATATCAATGGAGGAGCATCTCGAGATGCTCCTCCATTGATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1553s1c1
Sequence:CCGGGCAGGACTAAAGTTGTTAAATCTCGAGATTTAACAACTTTAGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1908s1c1
Sequence:CCGGCCTCCGTGAAACATTTCAAATCTCGAGATTTGAAATGTTTCACGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1881s1c1
Sequence:CCGGCCTGAAATACAATTCATGCAACTCGAGTTGCATGAATTGTATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-451s1c1
Sequence:CCGGGCCTACTTCCAAGAAGATGTTCTCGAGAACATCTTCTTGGAAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129694
EFHC1 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain (C-terminal) containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-472s1c1
Sequence:CCGGCCCATATCAATGGAGGAGCATCTCGAGATGCTCCTCCATTGATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1553s1c1
Sequence:CCGGGCAGGACTAAAGTTGTTAAATCTCGAGATTTAACAACTTTAGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1908s1c1
Sequence:CCGGCCTCCGTGAAACATTTCAAATCTCGAGATTTGAAATGTTTCACGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-1881s1c1
Sequence:CCGGCCTGAAATACAATTCATGCAACTCGAGTTGCATGAATTGTATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129694.3-451s1c1
Sequence:CCGGGCCTACTTCCAAGAAGATGTTCTCGAGAACATCTTCTTGGAAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks