EMAIL THIS PAGE TO A FRIEND

EFHC2

EF-hand domain (C-terminal) containing 2

Synonyms: dJ1158H2.1
UniProtKB ID: Q5JST6, Q5JST8, Q68DK4, Q8NEI0, Q9H653
Gene ID:
Human(80258) Summary: This gene encodes a protein which contains three DM10 domains and three calcium-binding EF-hand motifs. A related protein is encoded by a gene on chromosome 6. It has been suggested that both proteins are involved in the development of epilepsy (PMID: 15258581, 16112844) and that this gene may be associated with fear recognition in individuals with Turner syndrome. [provided by RefSeq, Aug 2011]
Mouse(74405) EF-hand domain (C-terminal) containing 2
Rat(302507) EF-hand domain (C-terminal) containing 2
Zebrafish(567323) EF-hand domain (C-terminal) containing 2
dog(480888) EF-hand domain (C-terminal) containing 2
domestic cat(101087561) EF-hand domain (C-terminal) containing 2
cow(100336399) EF-hand domain (C-terminal) containing 2
chicken(418559) EF-hand domain (C-terminal) containing 2
sheep(101103300) EF-hand domain (C-terminal) containing 2
domestic guinea pig(100714298) EF-hand domain (C-terminal) containing 2
naked mole-rat(101722211) EF-hand domain (C-terminal) containing 2
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024822 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025184 Rosetta Predictions human pricing
NM_001106952 Rosetta Predictions rat pricing
NM_028916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180237 predicted 1167
2 SASI_Hs01_00180238 predicted 453
3 SASI_Hs02_00357942 predicted 848
4 SASI_Hs01_00180239 predicted 937
5 SASI_Hs01_00180240 predicted 973
6 SASI_Hs01_00180241 predicted 1416
7 SASI_Hs01_00180242 predicted 659
8 SASI_Hs01_00180243 predicted 1651
9 SASI_Hs01_00180244 predicted 752
10 SASI_Hs01_00180245 predicted 1671
11 SASI_Hs01_00180246 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224026 predicted 2263
2 SASI_Rn02_00224027 predicted 755
3 SASI_Rn02_00224028 predicted 1196
4 SASI_Rn02_00224029 predicted 507
5 SASI_Rn02_00224030 predicted 927
6 SASI_Rn02_00224031 predicted 473
7 SASI_Rn02_00224032 predicted 743
8 SASI_Rn02_00224033 predicted 1162
9 SASI_Rn02_00224034 predicted 549
10 SASI_Rn02_00224035 predicted 2274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074144 predicted 1339
2 SASI_Mm01_00074145 predicted 1116
3 SASI_Mm01_00074146 predicted 920
4 SASI_Mm01_00074147 predicted 541
5 SASI_Mm01_00074148 predicted 1212
6 SASI_Mm01_00074149 predicted 1751
7 SASI_Mm02_00334595 predicted 1002
8 SASI_Mm01_00074151 predicted 202
9 SASI_Mm01_00074152 predicted 668
10 SASI_Mm01_00074153 predicted 491
11 SASI_Mm01_00074150 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028916
EFHC2 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain (C-terminal) containing 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028916.2-1122s1c1
Sequence:CCGGGAGTTTACCAAGACCTATTATCTCGAGATAATAGGTCTTGGTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028916.1-1601s1c1
Sequence:CCGGGCTACCTGTTTATTCTGCTTACTCGAGTAAGCAGAATAAACAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-995s1c1
Sequence:CCGGCAGATGGCTATCTGCTGGATACTCGAGTATCCAGCAGATAGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-103s1c1
Sequence:CCGGGAGAGGTTCCATAAATCTCAACTCGAGTTGAGATTTATGGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-1772s1c1
Sequence:CCGGCGAAGGTGGTAACTTACAATACTCGAGTATTGTAAGTTACCACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-2230s1c1
Sequence:CCGGCCTATTCCTGTGAAATACGTTCTCGAGAACGTATTTCACAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028916
EFHC2 MISSION shRNA shRNA Plasmid DNA
EF-hand domain (C-terminal) containing 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028916.2-1122s1c1
Sequence:CCGGGAGTTTACCAAGACCTATTATCTCGAGATAATAGGTCTTGGTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028916.1-1601s1c1
Sequence:CCGGGCTACCTGTTTATTCTGCTTACTCGAGTAAGCAGAATAAACAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-995s1c1
Sequence:CCGGCAGATGGCTATCTGCTGGATACTCGAGTATCCAGCAGATAGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-103s1c1
Sequence:CCGGGAGAGGTTCCATAAATCTCAACTCGAGTTGAGATTTATGGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-1772s1c1
Sequence:CCGGCGAAGGTGGTAACTTACAATACTCGAGTATTGTAAGTTACCACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-2230s1c1
Sequence:CCGGCCTATTCCTGTGAAATACGTTCTCGAGAACGTATTTCACAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028916
EFHC2 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain (C-terminal) containing 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028916.2-1122s1c1
Sequence:CCGGGAGTTTACCAAGACCTATTATCTCGAGATAATAGGTCTTGGTAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028916.1-1601s1c1
Sequence:CCGGGCTACCTGTTTATTCTGCTTACTCGAGTAAGCAGAATAAACAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-995s1c1
Sequence:CCGGCAGATGGCTATCTGCTGGATACTCGAGTATCCAGCAGATAGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-103s1c1
Sequence:CCGGGAGAGGTTCCATAAATCTCAACTCGAGTTGAGATTTATGGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-1772s1c1
Sequence:CCGGCGAAGGTGGTAACTTACAATACTCGAGTATTGTAAGTTACCACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028916.1-2230s1c1
Sequence:CCGGCCTATTCCTGTGAAATACGTTCTCGAGAACGTATTTCACAGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024822
EFHC2 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain (C-terminal) containing 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000149299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-352s1c1
Sequence:CCGGGCAAATCCTCCAGATTACCTTCTCGAGAAGGTAATCTGGAGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-159s1c1
Sequence:CCGGGAATTTGTAACCATTGCACGTCTCGAGACGTGCAATGGTTACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-481s1c1
Sequence:CCGGCTGAATTGCAACCAGCATCATCTCGAGATGATGCTGGTTGCAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-488s1c1
Sequence:CCGGGCAACCAGCATCATACCTTAACTCGAGTTAAGGTATGATGCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024822
EFHC2 MISSION shRNA shRNA Plasmid DNA
EF-hand domain (C-terminal) containing 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000149299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-352s1c1
Sequence:CCGGGCAAATCCTCCAGATTACCTTCTCGAGAAGGTAATCTGGAGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-159s1c1
Sequence:CCGGGAATTTGTAACCATTGCACGTCTCGAGACGTGCAATGGTTACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-481s1c1
Sequence:CCGGCTGAATTGCAACCAGCATCATCTCGAGATGATGCTGGTTGCAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-488s1c1
Sequence:CCGGGCAACCAGCATCATACCTTAACTCGAGTTAAGGTATGATGCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024822
EFHC2 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain (C-terminal) containing 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000149299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-352s1c1
Sequence:CCGGGCAAATCCTCCAGATTACCTTCTCGAGAAGGTAATCTGGAGGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-159s1c1
Sequence:CCGGGAATTTGTAACCATTGCACGTCTCGAGACGTGCAATGGTTACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-481s1c1
Sequence:CCGGCTGAATTGCAACCAGCATCATCTCGAGATGATGCTGGTTGCAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024822.1-488s1c1
Sequence:CCGGGCAACCAGCATCATACCTTAACTCGAGTTAAGGTATGATGCTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks