EMAIL THIS PAGE TO A FRIEND

EFHD1

EF-hand domain family, member D1

51 Gene Product Result for
Synonyms: MST133 MSTP133 SWS2
UniProtKB ID: Q9BUP0, B2RD83, E9PFH3, Q9BTF8, Q9H8I2, Q9HBQ0
Gene ID:
Human(80303) Summary: EFHD1 is an EF-hand domain-containing protein that displays increased expression during neuronal differentiation (Tominaga and Tomooka, 2002 [PubMed 12270117]
Mouse(98363) EF hand domain containing 1
Rat(501181) EF-hand domain family, member D1
naked mole-rat(101698219) EF-hand domain family, member D1
domestic guinea pig(100723842) EF-hand domain family, member D1
sheep(101113980) EF-hand domain family, member D1
Zebrafish(335521) EF-hand domain family, member D1
cow(522462) EF-hand domain family, member D1
domestic cat(101084645) EF-hand domain family, member D1
dog(486164) EF-hand domain family, member D1
chicken(424741) EF-hand domain family, member D1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025202 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025202 Rosetta Predictions human pricing
NM_001109310 Rosetta Predictions rat pricing
NM_028889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228164 predicted 678
2 SASI_Hs01_00228165 predicted 684
3 SASI_Hs01_00228166 predicted 589
4 SASI_Hs01_00228167 predicted 1032
5 SASI_Hs01_00228168 predicted 1126
6 SASI_Hs01_00228169 predicted 1116
7 SASI_Hs01_00228171 predicted 1282
8 SASI_Hs01_00228172 predicted 1284
9 SASI_Hs01_00228173 predicted 1225
10 SASI_Hs02_00357978 predicted 1205
11 SASI_Hs01_00228170 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247164 predicted 850
2 SASI_Rn02_00247165 predicted 841
3 SASI_Rn02_00247166 predicted 826
4 SASI_Rn02_00247167 predicted 819
5 SASI_Rn02_00247168 predicted 806
6 SASI_Rn02_00247169 predicted 804
7 SASI_Rn02_00247170 predicted 792
8 SASI_Rn02_00247171 predicted 511
9 SASI_Rn02_00247172 predicted 459
10 SASI_Rn02_00247173 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020027 predicted 1258
2 SASI_Mm01_00020028 predicted 1279
3 SASI_Mm01_00020029 predicted 1249
4 SASI_Mm01_00020030 predicted 1254
5 SASI_Mm01_00020031 predicted 1283
6 SASI_Mm01_00020032 predicted 1092
7 SASI_Mm02_00334575 predicted 945
8 SASI_Mm01_00020033 predicted 1270
9 SASI_Mm01_00020034 predicted 1117
10 SASI_Mm01_00020035 predicted 1249
11 SASI_Mm01_00020036 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028889
EFHD1 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain family, member D1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028889.1-1059s1c1
Sequence:CCGGCGTTTCTTCTTGGAAACCTTACTCGAGTAAGGTTTCCAAGAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-683s1c1
Sequence:CCGGCTTGTCATGTTCCAGTAAGTTCTCGAGAACTTACTGGAACATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-682s1c1
Sequence:CCGGCCTTGTCATGTTCCAGTAAGTCTCGAGACTTACTGGAACATGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-410s1c1
Sequence:CCGGCGGCTTTATTGACCTGATGGACTCGAGTCCATCAGGTCAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-697s1c1
Sequence:CCGGGTAAGTTCGAAGCTGAGTTAACTCGAGTTAACTCAGCTTCGAACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028889
EFHD1 MISSION shRNA shRNA Plasmid DNA
EF-hand domain family, member D1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028889.1-1059s1c1
Sequence:CCGGCGTTTCTTCTTGGAAACCTTACTCGAGTAAGGTTTCCAAGAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-683s1c1
Sequence:CCGGCTTGTCATGTTCCAGTAAGTTCTCGAGAACTTACTGGAACATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-682s1c1
Sequence:CCGGCCTTGTCATGTTCCAGTAAGTCTCGAGACTTACTGGAACATGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-410s1c1
Sequence:CCGGCGGCTTTATTGACCTGATGGACTCGAGTCCATCAGGTCAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-697s1c1
Sequence:CCGGGTAAGTTCGAAGCTGAGTTAACTCGAGTTAACTCAGCTTCGAACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028889
EFHD1 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain family, member D1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028889.1-1059s1c1
Sequence:CCGGCGTTTCTTCTTGGAAACCTTACTCGAGTAAGGTTTCCAAGAAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-683s1c1
Sequence:CCGGCTTGTCATGTTCCAGTAAGTTCTCGAGAACTTACTGGAACATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-682s1c1
Sequence:CCGGCCTTGTCATGTTCCAGTAAGTCTCGAGACTTACTGGAACATGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-410s1c1
Sequence:CCGGCGGCTTTATTGACCTGATGGACTCGAGTCCATCAGGTCAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028889.1-697s1c1
Sequence:CCGGGTAAGTTCGAAGCTGAGTTAACTCGAGTTAACTCAGCTTCGAACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025202
VALIDATED
EFHD1 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain family, member D1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-377s1c1
Sequence:CCGGGAGAGCATGTTCAAACTGTATCTCGAGATACAGTTTGAACATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-696s1c1
Sequence:CCGGCCAGTAAGTTTGAAGCAGAGTCTCGAGACTCTGCTTCAAACTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-1681s1c1
Sequence:CCGGGCCAGTTTCTAACATCTGTTTCTCGAGAAACAGATGTTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-781s1c1
Sequence:CCGGCCAGAAACTCAAGGCCAACTTCTCGAGAAGTTGGCCTTGAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-710s1c1
Sequence:CCGGGCAGAGTTGAAAGCTGAGCAACTCGAGTTGCTCAGCTTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025202
VALIDATED
EFHD1 MISSION shRNA shRNA Plasmid DNA
EF-hand domain family, member D1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-377s1c1
Sequence:CCGGGAGAGCATGTTCAAACTGTATCTCGAGATACAGTTTGAACATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-696s1c1
Sequence:CCGGCCAGTAAGTTTGAAGCAGAGTCTCGAGACTCTGCTTCAAACTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-1681s1c1
Sequence:CCGGGCCAGTTTCTAACATCTGTTTCTCGAGAAACAGATGTTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-781s1c1
Sequence:CCGGCCAGAAACTCAAGGCCAACTTCTCGAGAAGTTGGCCTTGAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-710s1c1
Sequence:CCGGGCAGAGTTGAAAGCTGAGCAACTCGAGTTGCTCAGCTTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025202
VALIDATED
EFHD1 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain family, member D1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-377s1c1
Sequence:CCGGGAGAGCATGTTCAAACTGTATCTCGAGATACAGTTTGAACATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-696s1c1
Sequence:CCGGCCAGTAAGTTTGAAGCAGAGTCTCGAGACTCTGCTTCAAACTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-1681s1c1
Sequence:CCGGGCCAGTTTCTAACATCTGTTTCTCGAGAAACAGATGTTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-781s1c1
Sequence:CCGGCCAGAAACTCAAGGCCAACTTCTCGAGAAGTTGGCCTTGAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025202.2-710s1c1
Sequence:CCGGGCAGAGTTGAAAGCTGAGCAACTCGAGTTGCTCAGCTTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks