EMAIL THIS PAGE TO A FRIEND

EFHD2

EF-hand domain family, member D2

74 Gene Product Result for
Synonyms: SWS1
UniProtKB ID: Q96C19, Q5JYW9
Gene ID:
Mouse(27984) EF hand domain containing 2
Rat(298609) EF-hand domain family, member D2
Zebrafish(571114) EF-hand domain family, member D2
cow(514259) EF-hand domain family, member D2
domestic cat(101083189) EF-hand domain family, member D2
dog(607254) EF-hand domain family, member D2
chicken(430669) EF-hand domain family, member D2
sheep(101109897) EF-hand domain family, member D2
domestic guinea pig(100716081) EF-hand domain family, member D2
naked mole-rat(101704104) EF-hand domain family, member D2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024329 Rosetta Predictions human pricing
NM_001031648 Rosetta Predictions rat pricing
NM_025994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186849 predicted 828
2 SASI_Hs01_00186847 predicted 477
3 SASI_Hs01_00186850 predicted 981
4 SASI_Hs01_00186848 predicted 445
5 SASI_Hs01_00186851 predicted 1942
6 SASI_Hs01_00186852 predicted 1874
7 SASI_Hs01_00186853 predicted 1613
8 SASI_Hs01_00186854 predicted 1480
9 SASI_Hs01_00186855 predicted 1988
10 SASI_Hs01_00186856 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047044 predicted 1210
2 SASI_Rn01_00047045 predicted 1066
3 SASI_Rn01_00047046 predicted 1048
4 SASI_Rn01_00047047 predicted 637
5 SASI_Rn02_00203585 predicted 965
6 SASI_Rn01_00047048 predicted 1137
7 SASI_Rn01_00047049 predicted 835
8 SASI_Rn01_00047050 predicted 1201
9 SASI_Rn01_00047051 predicted 862
10 SASI_Rn01_00047053 predicted 1080
11 SASI_Rn01_00047052 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163685 predicted 446
2 SASI_Mm01_00163686 predicted 1218
3 SASI_Mm01_00163687 predicted 865
4 SASI_Mm01_00163688 predicted 665
5 SASI_Mm01_00163689 predicted 436
6 SASI_Mm01_00163690 predicted 496
7 SASI_Mm01_00163691 predicted 915
8 SASI_Mm01_00163692 predicted 902
9 SASI_Mm01_00163693 predicted 603
10 SASI_Mm01_00163694 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025994
VALIDATED
EFHD2 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain family, member D2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025994.2-1932s1c1
Sequence:CCGGCGGTCTTAGAACCTATGAGAACTCGAGTTCTCATAGGTTCTAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-346s1c1
Sequence:CCGGGAGAAGATGTTCAAGCAGTATCTCGAGATACTGCTTGAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-732s1c1
Sequence:CCGGGCAGCGGAAAGCGGCCTTTAACTCGAGTTAAAGGCCGCTTTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-309s1c1
Sequence:CCGGGTTCAAGGAGTTCTCCAGGAACTCGAGTTCCTGGAGAACTCCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025994.2-475s1c1
Sequence:CCGGGACGAGGATTTCGACAGCAAACTCGAGTTTGCTGTCGAAATCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025994
VALIDATED
EFHD2 MISSION shRNA shRNA Plasmid DNA
EF-hand domain family, member D2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025994.2-1932s1c1
Sequence:CCGGCGGTCTTAGAACCTATGAGAACTCGAGTTCTCATAGGTTCTAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-346s1c1
Sequence:CCGGGAGAAGATGTTCAAGCAGTATCTCGAGATACTGCTTGAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-732s1c1
Sequence:CCGGGCAGCGGAAAGCGGCCTTTAACTCGAGTTAAAGGCCGCTTTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-309s1c1
Sequence:CCGGGTTCAAGGAGTTCTCCAGGAACTCGAGTTCCTGGAGAACTCCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025994.2-475s1c1
Sequence:CCGGGACGAGGATTTCGACAGCAAACTCGAGTTTGCTGTCGAAATCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025994
VALIDATED
EFHD2 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain family, member D2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025994.2-1932s1c1
Sequence:CCGGCGGTCTTAGAACCTATGAGAACTCGAGTTCTCATAGGTTCTAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-346s1c1
Sequence:CCGGGAGAAGATGTTCAAGCAGTATCTCGAGATACTGCTTGAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-732s1c1
Sequence:CCGGGCAGCGGAAAGCGGCCTTTAACTCGAGTTAAAGGCCGCTTTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025994.2-309s1c1
Sequence:CCGGGTTCAAGGAGTTCTCCAGGAACTCGAGTTCCTGGAGAACTCCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025994.2-475s1c1
Sequence:CCGGGACGAGGATTTCGACAGCAAACTCGAGTTTGCTGTCGAAATCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024329
VALIDATED
EFHD2 MISSION shRNA Bacterial Glycerol Stock
EF-hand domain family, member D2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1304s1c1
Sequence:CCGGGCGTCTTCCATCTACTGAAATCTCGAGATTTCAGTAGATGGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024329.4-306s1c1
Sequence:CCGGGATCAAGGACATGGAGAAGATCTCGAGATCTTCTCCATGTCCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024329.4-319s1c1
Sequence:CCGGGAGAAGATGTTCAAGCAGTATCTCGAGATACTGCTTGAACATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1665s1c1
Sequence:CCGGGTGCTTTAAGTGTGTTTGCATCTCGAGATGCAAACACACTTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024329.4-2115s1c1
Sequence:CCGGGCCTTAGAATCTGCAGAAATTCTCGAGAATTTCTGCAGATTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1996s1c1
Sequence:CCGGGCAACTTTCAGTGTGTGTCATCTCGAGATGACACACACTGAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024329.5-872s21c1
Sequence:CCGGCTGAATCCTTGCCTGTGTCTGCTCGAGCAGACACAGGCAAGGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024329.5-340s21c1
Sequence:CCGGAGTTCTCCAGGAAGCAGATCACTCGAGTGATCTGCTTCCTGGAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024329.5-889s21c1
Sequence:CCGGTCTGACGGGACCACTACTAAACTCGAGTTTAGTAGTGGTCCCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024329
VALIDATED
EFHD2 MISSION shRNA shRNA Plasmid DNA
EF-hand domain family, member D2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1304s1c1
Sequence:CCGGGCGTCTTCCATCTACTGAAATCTCGAGATTTCAGTAGATGGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024329.4-306s1c1
Sequence:CCGGGATCAAGGACATGGAGAAGATCTCGAGATCTTCTCCATGTCCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024329.4-319s1c1
Sequence:CCGGGAGAAGATGTTCAAGCAGTATCTCGAGATACTGCTTGAACATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1665s1c1
Sequence:CCGGGTGCTTTAAGTGTGTTTGCATCTCGAGATGCAAACACACTTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024329.4-2115s1c1
Sequence:CCGGGCCTTAGAATCTGCAGAAATTCTCGAGAATTTCTGCAGATTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1996s1c1
Sequence:CCGGGCAACTTTCAGTGTGTGTCATCTCGAGATGACACACACTGAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024329.5-872s21c1
Sequence:CCGGCTGAATCCTTGCCTGTGTCTGCTCGAGCAGACACAGGCAAGGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024329.5-340s21c1
Sequence:CCGGAGTTCTCCAGGAAGCAGATCACTCGAGTGATCTGCTTCCTGGAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024329.5-889s21c1
Sequence:CCGGTCTGACGGGACCACTACTAAACTCGAGTTTAGTAGTGGTCCCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024329
VALIDATED
EFHD2 MISSION shRNA Lentiviral Transduction Particles
EF-hand domain family, member D2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1304s1c1
Sequence:CCGGGCGTCTTCCATCTACTGAAATCTCGAGATTTCAGTAGATGGAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024329.4-306s1c1
Sequence:CCGGGATCAAGGACATGGAGAAGATCTCGAGATCTTCTCCATGTCCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024329.4-319s1c1
Sequence:CCGGGAGAAGATGTTCAAGCAGTATCTCGAGATACTGCTTGAACATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1665s1c1
Sequence:CCGGGTGCTTTAAGTGTGTTTGCATCTCGAGATGCAAACACACTTAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024329.4-2115s1c1
Sequence:CCGGGCCTTAGAATCTGCAGAAATTCTCGAGAATTTCTGCAGATTCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024329.4-1996s1c1
Sequence:CCGGGCAACTTTCAGTGTGTGTCATCTCGAGATGACACACACTGAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024329.5-872s21c1
Sequence:CCGGCTGAATCCTTGCCTGTGTCTGCTCGAGCAGACACAGGCAAGGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024329.5-340s21c1
Sequence:CCGGAGTTCTCCAGGAAGCAGATCACTCGAGTGATCTGCTTCCTGGAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024329.5-889s21c1
Sequence:CCGGTCTGACGGGACCACTACTAAACTCGAGTTTAGTAGTGGTCCCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks