EMAIL THIS PAGE TO A FRIEND

EFNA1

ephrin-A1

118 Gene Product Result for
Synonyms: B61 ECKLG EFL1 EPLG1 LERK-1 LERK1 TNFAIP4
UniProtKB ID: P20827, D3DV86, Q5SR60, Q5SR61, Q6I9T9, Q8N578
Gene ID:
Human(1942) Summary: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin which binds to the EPHA2, EPHA4, EPHA5, EPHA6, and EPHA7 receptors. Two transcript variants that encode different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
Mouse(13636) ephrin A1
Rat(94268) ephrin A1
dog(490431) ephrin-A1
cow(507319) ephrin-A1
sheep(101105624) ephrin-A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004428 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004428 Rosetta Predictions human pricing
NM_182685 Rosetta Predictions human pricing
NM_053599 Rosetta Predictions rat pricing
NM_010107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211016 predicted 239
2 SASI_Hs01_00211017 predicted 217
3 SASI_Hs01_00211018 predicted 241
4 SASI_Hs01_00211019 predicted 1062
5 SASI_Hs01_00211020 predicted 257
6 SASI_Hs01_00211022 predicted 824
7 SASI_Hs01_00211023 predicted 1011
8 SASI_Hs02_00337595 predicted 842
9 SASI_Hs01_00211024 predicted 836
10 SASI_Hs01_00211025 predicted 213
11 SASI_Hs01_00211021 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071683 predicted 243
2 SASI_Hs01_00071684 predicted 216
3 SASI_Hs01_00071685 predicted 245
4 SASI_Hs01_00071686 predicted 998
5 SASI_Hs01_00071687 predicted 258
6 SASI_Hs01_00071689 predicted 760
7 SASI_Hs01_00071690 predicted 947
8 SASI_Hs02_00370849 predicted 774
9 SASI_Hs01_00071691 predicted 768
10 SASI_Hs01_00071692 predicted 219
11 SASI_Hs01_00071688 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032631 predicted 1137
2 SASI_Rn01_00032632 predicted 748
3 SASI_Rn01_00032633 predicted 316
4 SASI_Rn01_00032634 predicted 552
5 SASI_Rn01_00032635 predicted 1006
6 SASI_Rn01_00032636 predicted 664
7 SASI_Rn01_00032637 predicted 381
8 SASI_Rn01_00032638 predicted 795
9 SASI_Rn01_00032639 predicted 395
10 SASI_Rn02_00266285 predicted 795
11 SASI_Rn01_00032640 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199815 predicted 1158
2 SASI_Mm01_00199816 predicted 726
3 SASI_Mm01_00199817 predicted 1030
4 SASI_Mm01_00199818 predicted 1085
5 SASI_Mm01_00199820 predicted 397
6 SASI_Mm01_00199821 predicted 797
7 SASI_Mm02_00317811 predicted 222
8 SASI_Mm01_00199822 predicted 407
9 SASI_Mm02_00317812 predicted 1069
10 SASI_Mm01_00199823 predicted 671
11 SASI_Mm01_00199819 predicted 401
12 SASI_Mm01_00199824 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004428
VALIDATED
EFNA1 MISSION shRNA Bacterial Glycerol Stock
ephrin-A1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-172s21c1
Sequence:CCGGGTCTTCTGGAACAGTTCAAATCTCGAGATTTGAACTGTTCCAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-289s21c1
Sequence:CCGGGCTGCCATGGAGCAGTACATACTCGAGTATGTACTGCTCCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-516s21c1
Sequence:CCGGAGACCGCTGCTTGAGGTTGAACTCGAGTTCAACCTCAAGCAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004428.2-1066s21c1
Sequence:CCGGGATGGGCAAAGCTTGTCAAAGCTCGAGCTTTGACAAGCTTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-248s21c1
Sequence:CCGGACATCATCTGTCCGCACTATGCTCGAGCATAGTGCGGACAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-730s21c1
Sequence:CCGGATGCCACACCTGGCCTTAAAGCTCGAGCTTTAAGGCCAGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-218s21c1
Sequence:CCGGCCATACATGTGCAGCTGAATGCTCGAGCATTCAGCTGCACATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-618s21c1
Sequence:CCGGAGAGGTGCGGGTTCTACATAGCTCGAGCTATGTAGAACCCGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-984s1c1
Sequence:CCGGCCTGCCTTTAAGCCAAAGAAACTCGAGTTTCTTTGGCTTAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004428.2-468s1c1
Sequence:CCGGAGAAGGACACAGCTACTACTACTCGAGTAGTAGTAGCTGTGTCCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-576s1c1
Sequence:CCGGCCATGACAATCCACAGGAGAACTCGAGTTCTCCTGTGGATTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-171s1c1
Sequence:CCGGCGTCTTCTGGAACAGTTCAAACTCGAGTTTGAACTGTTCCAGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-259s1c1
Sequence:CCGGCCGCACTATGAAGATCACTCTCTCGAGAGAGTGATCTTCATAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004428
VALIDATED
EFNA1 MISSION shRNA shRNA Plasmid DNA
ephrin-A1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-172s21c1
Sequence:CCGGGTCTTCTGGAACAGTTCAAATCTCGAGATTTGAACTGTTCCAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-289s21c1
Sequence:CCGGGCTGCCATGGAGCAGTACATACTCGAGTATGTACTGCTCCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-516s21c1
Sequence:CCGGAGACCGCTGCTTGAGGTTGAACTCGAGTTCAACCTCAAGCAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004428.2-1066s21c1
Sequence:CCGGGATGGGCAAAGCTTGTCAAAGCTCGAGCTTTGACAAGCTTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-248s21c1
Sequence:CCGGACATCATCTGTCCGCACTATGCTCGAGCATAGTGCGGACAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-730s21c1
Sequence:CCGGATGCCACACCTGGCCTTAAAGCTCGAGCTTTAAGGCCAGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-218s21c1
Sequence:CCGGCCATACATGTGCAGCTGAATGCTCGAGCATTCAGCTGCACATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-618s21c1
Sequence:CCGGAGAGGTGCGGGTTCTACATAGCTCGAGCTATGTAGAACCCGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-984s1c1
Sequence:CCGGCCTGCCTTTAAGCCAAAGAAACTCGAGTTTCTTTGGCTTAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004428.2-468s1c1
Sequence:CCGGAGAAGGACACAGCTACTACTACTCGAGTAGTAGTAGCTGTGTCCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-576s1c1
Sequence:CCGGCCATGACAATCCACAGGAGAACTCGAGTTCTCCTGTGGATTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-171s1c1
Sequence:CCGGCGTCTTCTGGAACAGTTCAAACTCGAGTTTGAACTGTTCCAGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-259s1c1
Sequence:CCGGCCGCACTATGAAGATCACTCTCTCGAGAGAGTGATCTTCATAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004428
VALIDATED
EFNA1 MISSION shRNA Lentiviral Transduction Particles
ephrin-A1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-172s21c1
Sequence:CCGGGTCTTCTGGAACAGTTCAAATCTCGAGATTTGAACTGTTCCAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-289s21c1
Sequence:CCGGGCTGCCATGGAGCAGTACATACTCGAGTATGTACTGCTCCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-516s21c1
Sequence:CCGGAGACCGCTGCTTGAGGTTGAACTCGAGTTCAACCTCAAGCAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004428.2-1066s21c1
Sequence:CCGGGATGGGCAAAGCTTGTCAAAGCTCGAGCTTTGACAAGCTTTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004428.2-248s21c1
Sequence:CCGGACATCATCTGTCCGCACTATGCTCGAGCATAGTGCGGACAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-730s21c1
Sequence:CCGGATGCCACACCTGGCCTTAAAGCTCGAGCTTTAAGGCCAGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-218s21c1
Sequence:CCGGCCATACATGTGCAGCTGAATGCTCGAGCATTCAGCTGCACATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004428.2-618s21c1
Sequence:CCGGAGAGGTGCGGGTTCTACATAGCTCGAGCTATGTAGAACCCGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-984s1c1
Sequence:CCGGCCTGCCTTTAAGCCAAAGAAACTCGAGTTTCTTTGGCTTAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004428.2-468s1c1
Sequence:CCGGAGAAGGACACAGCTACTACTACTCGAGTAGTAGTAGCTGTGTCCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-576s1c1
Sequence:CCGGCCATGACAATCCACAGGAGAACTCGAGTTCTCCTGTGGATTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-171s1c1
Sequence:CCGGCGTCTTCTGGAACAGTTCAAACTCGAGTTTGAACTGTTCCAGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004428.2-259s1c1
Sequence:CCGGCCGCACTATGAAGATCACTCTCTCGAGAGAGTGATCTTCATAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010107
VALIDATED
EFNA1 MISSION shRNA Bacterial Glycerol Stock
ephrin-A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010107.2-226s1c1
Sequence:CCGGGCTGAATGACTACCTAGACATCTCGAGATGTCTAGGTAGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-664s1c1
Sequence:CCGGCCCACTGGTCTGGGCAGTATTCTCGAGAATACTGCCCAGACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-401s1c1
Sequence:CCGGCCGGAGAAGCTGTCTGTGAAACTCGAGTTTCACAGACAGCTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-478s1c1
Sequence:CCGGCTACTACATCTCCAAACCTATCTCGAGATAGGTTTGGAGATGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-587s1c1
Sequence:CCGGGAGAAGAGACTCCAAGCAGATCTCGAGATCTGCTTGGAGTCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010107
VALIDATED
EFNA1 MISSION shRNA shRNA Plasmid DNA
ephrin-A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010107.2-226s1c1
Sequence:CCGGGCTGAATGACTACCTAGACATCTCGAGATGTCTAGGTAGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-664s1c1
Sequence:CCGGCCCACTGGTCTGGGCAGTATTCTCGAGAATACTGCCCAGACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-401s1c1
Sequence:CCGGCCGGAGAAGCTGTCTGTGAAACTCGAGTTTCACAGACAGCTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-478s1c1
Sequence:CCGGCTACTACATCTCCAAACCTATCTCGAGATAGGTTTGGAGATGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-587s1c1
Sequence:CCGGGAGAAGAGACTCCAAGCAGATCTCGAGATCTGCTTGGAGTCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010107
VALIDATED
EFNA1 MISSION shRNA Lentiviral Transduction Particles
ephrin-A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010107.2-226s1c1
Sequence:CCGGGCTGAATGACTACCTAGACATCTCGAGATGTCTAGGTAGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-664s1c1
Sequence:CCGGCCCACTGGTCTGGGCAGTATTCTCGAGAATACTGCCCAGACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-401s1c1
Sequence:CCGGCCGGAGAAGCTGTCTGTGAAACTCGAGTTTCACAGACAGCTTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-478s1c1
Sequence:CCGGCTACTACATCTCCAAACCTATCTCGAGATAGGTTTGGAGATGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010107.2-587s1c1
Sequence:CCGGGAGAAGAGACTCCAAGCAGATCTCGAGATCTGCTTGGAGTCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks