EMAIL THIS PAGE TO A FRIEND

EFNA2

ephrin-A2

59 Gene Product Result for
Synonyms: ELF-1 EPLG6 HEK7-L LERK-6 LERK6
UniProtKB ID: O43921, O76020
Gene ID:
Human(1943) Summary: This gene encodes a member of the ephrin family. The protein is composed of a signal sequence, a receptor-binding region, a spacer region, and a hydrophobic region. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. Posttranslational modifications determine whether this protein localizes to the nucleus or the cytoplasm. [provided by RefSeq, Jul 2008]
Mouse(13637) ephrin A2
Rat(84358) ephrin A2
Zebrafish(30218) ephrin A2
chicken(395831) ephrin-A2
cow(614453) ephrin-A2
sheep(101114443) ephrin-A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001405 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077761 MISSION® esiRNA esiRNA targeting mouse Efna2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001405 Rosetta Predictions human pricing
XM_001076723 Rosetta Predictions rat pricing
XM_234903 Rosetta Predictions rat pricing
NM_007909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017094 predicted 198
2 SASI_Hs01_00017095 predicted 478
3 SASI_Hs01_00017096 predicted 473
4 SASI_Hs01_00017097 predicted 241
5 SASI_Hs01_00017098 predicted 106
6 SASI_Hs01_00017099 predicted 110
7 SASI_Hs01_00017100 predicted 245
8 SASI_Hs01_00017101 predicted 507
9 SASI_Hs01_00017102 predicted 521
10 SASI_Hs02_00331787 predicted 179
11 SASI_Hs01_00017103 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354270 predicted 940
2 SASI_Rn02_00354271 predicted 822
3 SASI_Rn02_00354272 predicted 884
4 SASI_Rn02_00354273 predicted 347
5 SASI_Rn02_00354274 predicted 1024
6 SASI_Rn02_00354275 predicted 776
7 SASI_Rn02_00354276 predicted 830
8 SASI_Rn02_00354277 predicted 465
9 SASI_Rn02_00354278 predicted 998
10 SASI_Rn02_00354279 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388738 predicted 601
2 SASI_Rn02_00388739 predicted 937
3 SASI_Rn02_00388740 predicted 637
4 SASI_Rn02_00388741 predicted 851
5 SASI_Rn02_00388742 predicted 727
6 SASI_Rn02_00388743 predicted 735
7 SASI_Rn02_00388744 predicted 740
8 SASI_Rn02_00388745 predicted 639
9 SASI_Rn02_00388746 predicted 768
10 SASI_Rn02_00388747 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122865 predicted 644
2 SASI_Mm01_00122866 predicted 767
3 SASI_Mm01_00122867 predicted 786
4 SASI_Mm01_00122868 predicted 786
5 SASI_Mm01_00122869 predicted 810
6 SASI_Mm01_00122870 predicted 633
7 SASI_Mm01_00122871 predicted 814
8 SASI_Mm01_00122872 predicted 1290
9 SASI_Mm01_00122873 predicted 1291
10 SASI_Mm01_00122874 predicted 1338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007909
EFNA2 MISSION shRNA Bacterial Glycerol Stock
ephrin-A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-141s1c1
Sequence:CCGGCGCTGACCGATACGCAGTCTACTCGAGTAGACTGCGTATCGGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-539s1c1
Sequence:CCGGTCAAGGTTTATGTGCGTCCAACTCGAGTTGGACGCACATAAACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-556s1c1
Sequence:CCGGCCAACCAATGAGACCCTGTATCTCGAGATACAGGGTCTCATTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-411s1c1
Sequence:CCGGCCTCAAGTTCTCAGAGAAGTTCTCGAGAACTTCTCTGAGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-585s1c1
Sequence:CCGGAGAGCCCATCTTCACCAGTAACTCGAGTTACTGGTGAAGATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007909
EFNA2 MISSION shRNA shRNA Plasmid DNA
ephrin-A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-141s1c1
Sequence:CCGGCGCTGACCGATACGCAGTCTACTCGAGTAGACTGCGTATCGGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-539s1c1
Sequence:CCGGTCAAGGTTTATGTGCGTCCAACTCGAGTTGGACGCACATAAACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-556s1c1
Sequence:CCGGCCAACCAATGAGACCCTGTATCTCGAGATACAGGGTCTCATTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-411s1c1
Sequence:CCGGCCTCAAGTTCTCAGAGAAGTTCTCGAGAACTTCTCTGAGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-585s1c1
Sequence:CCGGAGAGCCCATCTTCACCAGTAACTCGAGTTACTGGTGAAGATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007909
EFNA2 MISSION shRNA Lentiviral Transduction Particles
ephrin-A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-141s1c1
Sequence:CCGGCGCTGACCGATACGCAGTCTACTCGAGTAGACTGCGTATCGGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-539s1c1
Sequence:CCGGTCAAGGTTTATGTGCGTCCAACTCGAGTTGGACGCACATAAACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-556s1c1
Sequence:CCGGCCAACCAATGAGACCCTGTATCTCGAGATACAGGGTCTCATTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-411s1c1
Sequence:CCGGCCTCAAGTTCTCAGAGAAGTTCTCGAGAACTTCTCTGAGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007909.1-585s1c1
Sequence:CCGGAGAGCCCATCTTCACCAGTAACTCGAGTTACTGGTGAAGATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001405
EFNA2 MISSION shRNA Bacterial Glycerol Stock
ephrin-A2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-369s1c1
Sequence:CCGGGCTCAAGTTCTCGGAGAAGTTCTCGAGAACTTCTCCGAGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-208s1c1
Sequence:CCGGGACATCTACTGCCCGCACTATCTCGAGATAGTGCGGGCAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-255s1c1
Sequence:CCGGCATGGAGCACTACGTGCTGTACTCGAGTACAGCACGTAGTGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-99s1c1
Sequence:CCGGCTCGGACCGCTACGCCGTCTACTCGAGTAGACGGCGTAGCGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-432s1c1
Sequence:CCGGCGGCCACGAGTATTACTACATCTCGAGATGTAGTAATACTCGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001405.2-556s21c1
Sequence:CCGGACCAGCAATAACTCGTGTAGCCTCGAGGCTACACGAGTTATTGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001405.2-175s21c1
Sequence:CCGGTACACGGTGGAGGTGAGCATCCTCGAGGATGCTCACCTCCACCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001405
EFNA2 MISSION shRNA shRNA Plasmid DNA
ephrin-A2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-369s1c1
Sequence:CCGGGCTCAAGTTCTCGGAGAAGTTCTCGAGAACTTCTCCGAGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-208s1c1
Sequence:CCGGGACATCTACTGCCCGCACTATCTCGAGATAGTGCGGGCAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-255s1c1
Sequence:CCGGCATGGAGCACTACGTGCTGTACTCGAGTACAGCACGTAGTGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-99s1c1
Sequence:CCGGCTCGGACCGCTACGCCGTCTACTCGAGTAGACGGCGTAGCGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-432s1c1
Sequence:CCGGCGGCCACGAGTATTACTACATCTCGAGATGTAGTAATACTCGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001405.2-556s21c1
Sequence:CCGGACCAGCAATAACTCGTGTAGCCTCGAGGCTACACGAGTTATTGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001405.2-175s21c1
Sequence:CCGGTACACGGTGGAGGTGAGCATCCTCGAGGATGCTCACCTCCACCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001405
EFNA2 MISSION shRNA Lentiviral Transduction Particles
ephrin-A2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-369s1c1
Sequence:CCGGGCTCAAGTTCTCGGAGAAGTTCTCGAGAACTTCTCCGAGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-208s1c1
Sequence:CCGGGACATCTACTGCCCGCACTATCTCGAGATAGTGCGGGCAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-255s1c1
Sequence:CCGGCATGGAGCACTACGTGCTGTACTCGAGTACAGCACGTAGTGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-99s1c1
Sequence:CCGGCTCGGACCGCTACGCCGTCTACTCGAGTAGACGGCGTAGCGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001405.2-432s1c1
Sequence:CCGGCGGCCACGAGTATTACTACATCTCGAGATGTAGTAATACTCGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001405.2-556s21c1
Sequence:CCGGACCAGCAATAACTCGTGTAGCCTCGAGGCTACACGAGTTATTGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001405.2-175s21c1
Sequence:CCGGTACACGGTGGAGGTGAGCATCCTCGAGGATGCTCACCTCCACCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks