EMAIL THIS PAGE TO A FRIEND

EFNA3

ephrin-A3

179 Gene Product Result for
Synonyms: EFL2 EPLG3 Ehk1-L LERK3
UniProtKB ID: P52797, D3DV85, Q0VGC9, Q5SR70
Gene ID:
Human(1944) Summary: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin. [provided by RefSeq, Jul 2008]
Mouse(13638) ephrin A3
Rat(170901) ephrin A3
sheep(101115414) ephrin-A3
cow(540776) ephrin-A3
dog(490432) ephrin-A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_204001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_204001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_204001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004952 Rosetta Predictions human pricing
XM_001072619 Rosetta Predictions rat pricing
XM_001072657 Rosetta Predictions rat pricing
XM_574979 Rosetta Predictions rat pricing
NM_010108 Rosetta Predictions mouse pricing
XM_892839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126324 predicted 1012
2 SASI_Hs01_00126325 predicted 1008
3 SASI_Hs01_00126327 predicted 545
4 SASI_Hs01_00126328 predicted 553
5 SASI_Hs01_00126329 predicted 517
6 SASI_Hs01_00126326 predicted 1250
7 SASI_Hs01_00126330 predicted 676
8 SASI_Hs01_00126331 predicted 216
9 SASI_Hs01_00126332 predicted 208
10 SASI_Hs02_00338630 predicted 523
11 SASI_Hs01_00126333 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339901 predicted 727
2 SASI_Rn02_00339902 predicted 956
3 SASI_Rn02_00339903 predicted 976
4 SASI_Rn02_00339904 predicted 586
5 SASI_Rn02_00339905 predicted 1044
6 SASI_Rn02_00339906 predicted 868
7 SASI_Rn02_00339907 predicted 528
8 SASI_Rn02_00339908 predicted 900
9 SASI_Rn02_00339909 predicted 557
10 SASI_Rn02_00339910 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340064 predicted 809
2 SASI_Rn02_00340065 predicted 1037
3 SASI_Rn02_00340066 predicted 1062
4 SASI_Rn02_00340067 predicted 1124
5 SASI_Rn02_00340068 predicted 932
6 SASI_Rn02_00340069 predicted 951
7 SASI_Rn02_00340070 predicted 529
8 SASI_Rn02_00340071 predicted 590
9 SASI_Rn02_00340072 predicted 983
10 SASI_Rn02_00340073 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402856 predicted 869
2 SASI_Rn02_00402857 predicted 893
3 SASI_Rn02_00402858 predicted 943
4 SASI_Rn02_00402859 predicted 1004
5 SASI_Rn02_00402860 predicted 1077
6 SASI_Rn02_00402861 predicted 526
7 SASI_Rn02_00402862 predicted 590
8 SASI_Rn02_00402863 predicted 822
9 SASI_Rn02_00402864 predicted 550
10 SASI_Rn02_00402865 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317813 predicted 976
2 SASI_Mm02_00317814 predicted 946
3 SASI_Mm02_00317815 predicted 799
4 SASI_Mm02_00317816 predicted 893
5 SASI_Mm02_00317817 predicted 860
6 SASI_Mm02_00317818 predicted 861
7 SASI_Mm02_00317819 predicted 940
8 SASI_Mm02_00317820 predicted 878
9 SASI_Mm02_00317821 predicted 603
10 SASI_Mm02_00317822 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266134 predicted 1065
2 SASI_Mm01_00266135 predicted 1044
3 SASI_Mm01_00266136 predicted 503
4 SASI_Mm01_00266137 predicted 478
5 SASI_Mm01_00266138 predicted 1272
6 SASI_Mm01_00266139 predicted 898
7 SASI_Mm01_00266140 predicted 504
8 SASI_Mm01_00266141 predicted 979
9 SASI_Mm01_00266142 predicted 951
10 SASI_Mm01_00266143 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004952
VALIDATED
EFNA3 MISSION shRNA Bacterial Glycerol Stock
ephrin-A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-1006s21c1
Sequence:CCGGCCTTGTGGCTCTGGTAATGTTCTCGAGAACATTACCAGAGCCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-766s21c1
Sequence:CCGGCATGACGTTCTTGGCCTCCTACTCGAGTAGGAGGCCAAGAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-232s21c1
Sequence:CCGGCGTGAACGACTATCTGGATATCTCGAGATATCCAGATAGTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004952.4-331s21c1
Sequence:CCGGGCTGTACATGGTGAGCCGCAACTCGAGTTGCGGCTCACCATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-536s21c1
Sequence:CCGGTGGAAGTGTCTGAGGATGAAGCTCGAGCTTCATCCTCAGACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-223s1c1
Sequence:CCGGGCAGGTGAACGTGAACGACTACTCGAGTAGTCGTTCACGTTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-640s1c1
Sequence:CCGGGAAGATCAACGTGCTGGAAGACTCGAGTCTTCCAGCACGTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004952.3-232s1c1
Sequence:CCGGCGTGAACGACTATCTGGATATCTCGAGATATCCAGATAGTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-766s1c1
Sequence:CCGGCATGACGTTCTTGGCCTCCTACTCGAGTAGGAGGCCAAGAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-331s1c1
Sequence:CCGGGCTGTACATGGTGAGCCGCAACTCGAGTTGCGGCTCACCATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004952
VALIDATED
EFNA3 MISSION shRNA shRNA Plasmid DNA
ephrin-A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-1006s21c1
Sequence:CCGGCCTTGTGGCTCTGGTAATGTTCTCGAGAACATTACCAGAGCCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-766s21c1
Sequence:CCGGCATGACGTTCTTGGCCTCCTACTCGAGTAGGAGGCCAAGAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-232s21c1
Sequence:CCGGCGTGAACGACTATCTGGATATCTCGAGATATCCAGATAGTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004952.4-331s21c1
Sequence:CCGGGCTGTACATGGTGAGCCGCAACTCGAGTTGCGGCTCACCATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-536s21c1
Sequence:CCGGTGGAAGTGTCTGAGGATGAAGCTCGAGCTTCATCCTCAGACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-223s1c1
Sequence:CCGGGCAGGTGAACGTGAACGACTACTCGAGTAGTCGTTCACGTTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-640s1c1
Sequence:CCGGGAAGATCAACGTGCTGGAAGACTCGAGTCTTCCAGCACGTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004952.3-232s1c1
Sequence:CCGGCGTGAACGACTATCTGGATATCTCGAGATATCCAGATAGTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-766s1c1
Sequence:CCGGCATGACGTTCTTGGCCTCCTACTCGAGTAGGAGGCCAAGAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-331s1c1
Sequence:CCGGGCTGTACATGGTGAGCCGCAACTCGAGTTGCGGCTCACCATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004952
VALIDATED
EFNA3 MISSION shRNA Lentiviral Transduction Particles
ephrin-A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-1006s21c1
Sequence:CCGGCCTTGTGGCTCTGGTAATGTTCTCGAGAACATTACCAGAGCCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-766s21c1
Sequence:CCGGCATGACGTTCTTGGCCTCCTACTCGAGTAGGAGGCCAAGAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-232s21c1
Sequence:CCGGCGTGAACGACTATCTGGATATCTCGAGATATCCAGATAGTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004952.4-331s21c1
Sequence:CCGGGCTGTACATGGTGAGCCGCAACTCGAGTTGCGGCTCACCATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004952.4-536s21c1
Sequence:CCGGTGGAAGTGTCTGAGGATGAAGCTCGAGCTTCATCCTCAGACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-223s1c1
Sequence:CCGGGCAGGTGAACGTGAACGACTACTCGAGTAGTCGTTCACGTTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-640s1c1
Sequence:CCGGGAAGATCAACGTGCTGGAAGACTCGAGTCTTCCAGCACGTTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004952.3-232s1c1
Sequence:CCGGCGTGAACGACTATCTGGATATCTCGAGATATCCAGATAGTCGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-766s1c1
Sequence:CCGGCATGACGTTCTTGGCCTCCTACTCGAGTAGGAGGCCAAGAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004952.3-331s1c1
Sequence:CCGGGCTGTACATGGTGAGCCGCAACTCGAGTTGCGGCTCACCATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_204001
VALIDATED
EFNA3 MISSION shRNA Bacterial Glycerol Stock
ephrin-A3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_204001.4-1380s1c1
Sequence:CCGGCCCTTCTTAACCTTGACCTTTCTCGAGAAAGGTCAAGGTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-381s1c1
Sequence:CCGGCATCAAGTTCTCCGAGAAGTTCTCGAGAACTTCTCGGAGAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-592s1c1
Sequence:CCGGGTGAAGATCAACGTGTTGGAACTCGAGTTCCAACACGTTGATCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-444s1c1
Sequence:CCGGCGGCCAAGAATACTACTACATCTCGAGATGTAGTAGTATTCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-610s1c1
Sequence:CCGGGAAGACTTTGAGGGAGAGAATCTCGAGATTCTCTCCCTCAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_204001
VALIDATED
EFNA3 MISSION shRNA shRNA Plasmid DNA
ephrin-A3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_204001.4-1380s1c1
Sequence:CCGGCCCTTCTTAACCTTGACCTTTCTCGAGAAAGGTCAAGGTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-381s1c1
Sequence:CCGGCATCAAGTTCTCCGAGAAGTTCTCGAGAACTTCTCGGAGAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-592s1c1
Sequence:CCGGGTGAAGATCAACGTGTTGGAACTCGAGTTCCAACACGTTGATCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-444s1c1
Sequence:CCGGCGGCCAAGAATACTACTACATCTCGAGATGTAGTAGTATTCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-610s1c1
Sequence:CCGGGAAGACTTTGAGGGAGAGAATCTCGAGATTCTCTCCCTCAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_204001
VALIDATED
EFNA3 MISSION shRNA Lentiviral Transduction Particles
ephrin-A3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_204001.4-1380s1c1
Sequence:CCGGCCCTTCTTAACCTTGACCTTTCTCGAGAAAGGTCAAGGTTAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-381s1c1
Sequence:CCGGCATCAAGTTCTCCGAGAAGTTCTCGAGAACTTCTCGGAGAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-592s1c1
Sequence:CCGGGTGAAGATCAACGTGTTGGAACTCGAGTTCCAACACGTTGATCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-444s1c1
Sequence:CCGGCGGCCAAGAATACTACTACATCTCGAGATGTAGTAGTATTCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_204001.4-610s1c1
Sequence:CCGGGAAGACTTTGAGGGAGAGAATCTCGAGATTCTCTCCCTCAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks