EMAIL THIS PAGE TO A FRIEND

EFNA4

ephrin-A4

105 Gene Product Result for
Synonyms: EFL4 EPLG4 LERK4
UniProtKB ID: P52798, C9JHJ8, G3XAK2, O95457, Q5SR71, Q6FI57
Gene ID:
Human(1945) Summary: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin. Three transcript variants that encode distinct proteins have been identified. [provided by RefSeq, Jul 2008]
Mouse(13639) ephrin A4
Rat(310643) ephrin A4
dog(490433) ephrin-A4
cow(615879) ephrin-A4
sheep(101105380) ephrin-A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500700 Anti-EFNA4, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
E7275 Anti-Ephrin-A4 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005227 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005227 Rosetta Predictions human pricing
NM_182689 Rosetta Predictions human pricing
NM_182690 Rosetta Predictions human pricing
NM_001107692 Rosetta Predictions rat pricing
NM_007910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065644 predicted 291
2 SASI_Hs01_00065645 predicted 294
3 SASI_Hs01_00065646 predicted 929
4 SASI_Hs01_00065647 predicted 225
5 SASI_Hs01_00065648 predicted 297
6 SASI_Hs01_00065649 predicted 316
7 SASI_Hs01_00065650 predicted 226
8 SASI_Hs02_00339215 predicted 223
9 SASI_Hs01_00065651 predicted 919
10 SASI_Hs01_00065652 predicted 231
11 SASI_Hs01_00065653 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189938 predicted 294
2 SASI_Hs01_00189939 predicted 288
3 SASI_Hs01_00189940 predicted 760
4 SASI_Hs01_00189941 predicted 225
5 SASI_Hs01_00189942 predicted 291
6 SASI_Hs01_00189943 predicted 312
7 SASI_Hs01_00189944 predicted 231
8 SASI_Hs02_00370856 predicted 220
9 SASI_Hs01_00189945 predicted 755
10 SASI_Hs01_00189946 predicted 229
11 SASI_Hs01_00189947 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193577 predicted 290
2 SASI_Hs01_00193578 predicted 290
3 SASI_Hs01_00193579 predicted 783
4 SASI_Hs01_00193580 predicted 228
5 SASI_Hs01_00193581 predicted 290
6 SASI_Hs01_00193582 predicted 319
7 SASI_Hs01_00193583 predicted 234
8 SASI_Hs02_00370857 predicted 225
9 SASI_Hs01_00193584 predicted 772
10 SASI_Hs01_00193585 predicted 235
11 SASI_Hs01_00193586 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231335 predicted 265
2 SASI_Rn02_00231336 predicted 206
3 SASI_Rn02_00231337 predicted 661
4 SASI_Rn02_00231338 predicted 376
5 SASI_Rn02_00231339 predicted 842
6 SASI_Rn02_00231340 predicted 265
7 SASI_Rn02_00231341 predicted 894
8 SASI_Rn02_00231342 predicted 341
9 SASI_Rn02_00231343 predicted 809
10 SASI_Rn02_00231344 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312715 predicted 283
2 SASI_Mm02_00312716 predicted 1095
3 SASI_Mm02_00312717 predicted 865
4 SASI_Mm01_00048084 predicted 246
5 SASI_Mm01_00048085 predicted 391
6 SASI_Mm02_00312718 predicted 799
7 SASI_Mm02_00312719 predicted 696
8 SASI_Mm01_00048086 predicted 216
9 SASI_Mm02_00312720 predicted 825
10 SASI_Mm02_00312721 predicted 1096
11 SASI_Mm01_00048083 predicted 289
12 SASI_Mm01_00048087 predicted 553
13 SASI_Mm01_00048088 predicted 345
14 SASI_Mm01_00048089 predicted 282
15 SASI_Mm01_00048090 predicted 367
16 SASI_Mm01_00048091 predicted 469
17 SASI_Mm01_00048092 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007910
VALIDATED
EFNA4 MISSION shRNA Bacterial Glycerol Stock
ephrin-A4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-398s1c1
Sequence:CCGGGCCCTGTTCGATTCTCAGAAACTCGAGTTTCTGAGAATCGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-285s1c1
Sequence:CCGGCCCGGAAACCTTTGCATTATACTCGAGTATAATGCAAAGGTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007910.1-559s1c1
Sequence:CCGGTCATCACATGAGTCAGCTCATCTCGAGATGAGCTGACTCATGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-462s1c1
Sequence:CCGGGCCTGGAGAGACTTACTACTACTCGAGTAGTAGTAAGTCTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-246s21c1
Sequence:CCGGCTTCTGCCCACATTATGAAAGCTCGAGCTTTCATAATGTGGGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007910.2-1162s21c1
Sequence:CCGGACTTGCCATGAGGTTGAATTTCTCGAGAAATTCAACCTCATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-220s21c1
Sequence:CCGGCTGGGCTTCAACGATTACCTACTCGAGTAGGTAATCGTTGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-398s21c1
Sequence:CCGGGCCCTGTTCGATTCTCAGAAACTCGAGTTTCTGAGAATCGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-286s21c1
Sequence:CCGGCCGGAAACCTTTGCATTATACCTCGAGGTATAATGCAAAGGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007910
VALIDATED
EFNA4 MISSION shRNA shRNA Plasmid DNA
ephrin-A4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-398s1c1
Sequence:CCGGGCCCTGTTCGATTCTCAGAAACTCGAGTTTCTGAGAATCGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-285s1c1
Sequence:CCGGCCCGGAAACCTTTGCATTATACTCGAGTATAATGCAAAGGTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007910.1-559s1c1
Sequence:CCGGTCATCACATGAGTCAGCTCATCTCGAGATGAGCTGACTCATGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-462s1c1
Sequence:CCGGGCCTGGAGAGACTTACTACTACTCGAGTAGTAGTAAGTCTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-246s21c1
Sequence:CCGGCTTCTGCCCACATTATGAAAGCTCGAGCTTTCATAATGTGGGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007910.2-1162s21c1
Sequence:CCGGACTTGCCATGAGGTTGAATTTCTCGAGAAATTCAACCTCATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-220s21c1
Sequence:CCGGCTGGGCTTCAACGATTACCTACTCGAGTAGGTAATCGTTGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-398s21c1
Sequence:CCGGGCCCTGTTCGATTCTCAGAAACTCGAGTTTCTGAGAATCGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-286s21c1
Sequence:CCGGCCGGAAACCTTTGCATTATACCTCGAGGTATAATGCAAAGGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007910
VALIDATED
EFNA4 MISSION shRNA Lentiviral Transduction Particles
ephrin-A4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-398s1c1
Sequence:CCGGGCCCTGTTCGATTCTCAGAAACTCGAGTTTCTGAGAATCGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-285s1c1
Sequence:CCGGCCCGGAAACCTTTGCATTATACTCGAGTATAATGCAAAGGTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007910.1-559s1c1
Sequence:CCGGTCATCACATGAGTCAGCTCATCTCGAGATGAGCTGACTCATGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007910.1-462s1c1
Sequence:CCGGGCCTGGAGAGACTTACTACTACTCGAGTAGTAGTAAGTCTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-246s21c1
Sequence:CCGGCTTCTGCCCACATTATGAAAGCTCGAGCTTTCATAATGTGGGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007910.2-1162s21c1
Sequence:CCGGACTTGCCATGAGGTTGAATTTCTCGAGAAATTCAACCTCATGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-220s21c1
Sequence:CCGGCTGGGCTTCAACGATTACCTACTCGAGTAGGTAATCGTTGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-398s21c1
Sequence:CCGGGCCCTGTTCGATTCTCAGAAACTCGAGTTTCTGAGAATCGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007910.2-286s21c1
Sequence:CCGGCCGGAAACCTTTGCATTATACCTCGAGGTATAATGCAAAGGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005227
VALIDATED
EFNA4 MISSION shRNA Bacterial Glycerol Stock
ephrin-A4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-399s1c1
Sequence:CCGGCCATGTTCAATTCTCAGAGAACTCGAGTTCTCTGAGAATTGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-465s1c1
Sequence:CCGGTGGAGAGACTTACTACTACATCTCGAGATGTAGTAGTAAGTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-643s1c1
Sequence:CCGGCTCTTGCTATTACTGCTGCTTCTCGAGAAGCAGCAGTAATAGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-174s1c1
Sequence:CCGGAGTCTACTGGAACTCCAGTAACTCGAGTTACTGGAGTTCCAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-235s1c1
Sequence:CCGGCTCAACGATTACCTAGACATTCTCGAGAATGTCTAGGTAATCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-399s21c1
Sequence:CCGGCCATGTTCAATTCTCAGAGAACTCGAGTTCTCTGAGAATTGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-174s21c1
Sequence:CCGGAGTCTACTGGAACTCCAGTAACTCGAGTTACTGGAGTTCCAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-465s21c1
Sequence:CCGGTGGAGAGACTTACTACTACATCTCGAGATGTAGTAGTAAGTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-443s21c1
Sequence:CCGGCCCTCGGCTTTGAGTTCTTACCTCGAGGTAAGAACTCAAAGCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005227.2-794s21c1
Sequence:CCGGGACCGACAAGATGGAGCATTGCTCGAGCAATGCTCCATCTTGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005227
VALIDATED
EFNA4 MISSION shRNA shRNA Plasmid DNA
ephrin-A4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-399s1c1
Sequence:CCGGCCATGTTCAATTCTCAGAGAACTCGAGTTCTCTGAGAATTGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-465s1c1
Sequence:CCGGTGGAGAGACTTACTACTACATCTCGAGATGTAGTAGTAAGTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-643s1c1
Sequence:CCGGCTCTTGCTATTACTGCTGCTTCTCGAGAAGCAGCAGTAATAGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-174s1c1
Sequence:CCGGAGTCTACTGGAACTCCAGTAACTCGAGTTACTGGAGTTCCAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-235s1c1
Sequence:CCGGCTCAACGATTACCTAGACATTCTCGAGAATGTCTAGGTAATCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-399s21c1
Sequence:CCGGCCATGTTCAATTCTCAGAGAACTCGAGTTCTCTGAGAATTGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-174s21c1
Sequence:CCGGAGTCTACTGGAACTCCAGTAACTCGAGTTACTGGAGTTCCAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-465s21c1
Sequence:CCGGTGGAGAGACTTACTACTACATCTCGAGATGTAGTAGTAAGTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-443s21c1
Sequence:CCGGCCCTCGGCTTTGAGTTCTTACCTCGAGGTAAGAACTCAAAGCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005227.2-794s21c1
Sequence:CCGGGACCGACAAGATGGAGCATTGCTCGAGCAATGCTCCATCTTGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005227
VALIDATED
EFNA4 MISSION shRNA Lentiviral Transduction Particles
ephrin-A4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-399s1c1
Sequence:CCGGCCATGTTCAATTCTCAGAGAACTCGAGTTCTCTGAGAATTGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-465s1c1
Sequence:CCGGTGGAGAGACTTACTACTACATCTCGAGATGTAGTAGTAAGTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-643s1c1
Sequence:CCGGCTCTTGCTATTACTGCTGCTTCTCGAGAAGCAGCAGTAATAGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-174s1c1
Sequence:CCGGAGTCTACTGGAACTCCAGTAACTCGAGTTACTGGAGTTCCAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005227.2-235s1c1
Sequence:CCGGCTCAACGATTACCTAGACATTCTCGAGAATGTCTAGGTAATCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-399s21c1
Sequence:CCGGCCATGTTCAATTCTCAGAGAACTCGAGTTCTCTGAGAATTGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-174s21c1
Sequence:CCGGAGTCTACTGGAACTCCAGTAACTCGAGTTACTGGAGTTCCAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-465s21c1
Sequence:CCGGTGGAGAGACTTACTACTACATCTCGAGATGTAGTAGTAAGTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005227.2-443s21c1
Sequence:CCGGCCCTCGGCTTTGAGTTCTTACCTCGAGGTAAGAACTCAAAGCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005227.2-794s21c1
Sequence:CCGGGACCGACAAGATGGAGCATTGCTCGAGCAATGCTCCATCTTGTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks