EMAIL THIS PAGE TO A FRIEND

EFNA5

ephrin-A5

Synonyms: AF1 EFL5 EPLG7 GLC1M LERK7 RAGS
UniProtKB ID: P52803
Gene ID:
Human(1946) Summary: Ephrin-A5, a member of the ephrin gene family, prevents axon bundling in cocultures of cortical neurons with astrocytes, a model of late stage nervous system development and differentiation. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
Mouse(13640) ephrin A5
Rat(116683) ephrin A5
sheep(101115792) ephrin-A5
chicken(396100) ephrin-A5
cow(616742) ephrin-A5
dog(608458) ephrin-A5
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001962 Rosetta Predictions human pricing
NM_053903 Rosetta Predictions rat pricing
NM_010109 Rosetta Predictions mouse pricing
NM_207654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058371 predicted 758
2 SASI_Hs01_00058372 predicted 417
3 SASI_Hs01_00058373 predicted 501
4 SASI_Hs01_00058374 predicted 420
5 SASI_Hs01_00058375 predicted 832
6 SASI_Hs02_00332914 predicted 343
7 SASI_Hs01_00058377 predicted 753
8 SASI_Hs01_00058378 predicted 511
9 SASI_Hs01_00058379 predicted 903
10 SASI_Hs01_00058380 predicted 598
11 SASI_Hs01_00058376 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112742 predicted 257
2 SASI_Rn01_00112743 predicted 486
3 SASI_Rn01_00112744 predicted 430
4 SASI_Rn01_00112745 predicted 510
5 SASI_Rn02_00266831 predicted 482
6 SASI_Rn01_00112748 predicted 498
7 SASI_Rn02_00266832 predicted 512
8 SASI_Rn01_00112749 predicted 244
9 SASI_Rn01_00112750 predicted 318
10 SASI_Rn02_00266833 predicted 259
11 SASI_Rn01_00112741 predicted 378
12 SASI_Rn01_00112746 predicted 311
13 SASI_Rn01_00112747 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091584 predicted 413
2 SASI_Mm01_00091585 predicted 1249
3 SASI_Mm01_00091586 predicted 321
4 SASI_Mm01_00091587 predicted 1131
5 SASI_Mm01_00091589 predicted 630
6 SASI_Mm01_00091590 predicted 659
7 SASI_Mm01_00091591 predicted 328
8 SASI_Mm01_00091592 predicted 844
9 SASI_Mm02_00317823 predicted 921
10 SASI_Mm02_00317824 predicted 860
11 SASI_Mm01_00091588 predicted 1155
12 SASI_Mm01_00091593 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110767 predicted 408
2 SASI_Mm01_00110768 predicted 1333
3 SASI_Mm01_00110769 predicted 665
4 SASI_Mm01_00110770 predicted 314
5 SASI_Mm01_00110771 predicted 1215
6 SASI_Mm01_00110774 predicted 630
7 SASI_Mm01_00110775 predicted 322
8 SASI_Mm02_00352173 predicted 706
9 SASI_Mm01_00110776 predicted 932
10 SASI_Mm02_00352174 predicted 743
11 SASI_Mm01_00110772 predicted 1238
12 SASI_Mm01_00110773 predicted 644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001962
VALIDATED
EFNA5 MISSION shRNA Bacterial Glycerol Stock
ephrin-A5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-841s21c1
Sequence:CCGGCCAGCAGATGACACCGTACATCTCGAGATGTACGGTGTCATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-417s21c1
Sequence:CCGGGGGTGACTACCATATTGATGTCTCGAGACATCAATATGGTAGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001962.2-1043s21c1
Sequence:CCGGTCCTAAGAAGGGACTTGTTATCTCGAGATAACAAGTCCCTTCTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-729s21c1
Sequence:CCGGGTCCTGTCTAAAGCTCAAAGTCTCGAGACTTTGAGCTTTAGACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-804s21c1
Sequence:CCGGTTTCGATGTTAACGACAAAGTCTCGAGACTTTGTCGTTAACATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-782s21c1
Sequence:CCGGCTATAGGTGTTCATGATCGTGCTCGAGCACGATCATGAACACCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-756s1c1
Sequence:CCGGGAGACCAACAAATAGCTGTATCTCGAGATACAGCTATTTGTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-514s1c1
Sequence:CCGGGTCCTCTACATGGTGAACTTTCTCGAGAAAGTTCACCATGTAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-891s1c1
Sequence:CCGGCGCGGCACAAACACCAAGGATCTCGAGATCCTTGGTGTTTGTGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-707s1c1
Sequence:CCGGCAATCCCAGATAATGGAAGAACTCGAGTTCTTCCATTATCTGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001962.1-555s1c1
Sequence:CCGGCCACACTTCCAAAGGGTTCAACTCGAGTTGAACCCTTTGGAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001962
VALIDATED
EFNA5 MISSION shRNA shRNA Plasmid DNA
ephrin-A5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-841s21c1
Sequence:CCGGCCAGCAGATGACACCGTACATCTCGAGATGTACGGTGTCATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-417s21c1
Sequence:CCGGGGGTGACTACCATATTGATGTCTCGAGACATCAATATGGTAGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001962.2-1043s21c1
Sequence:CCGGTCCTAAGAAGGGACTTGTTATCTCGAGATAACAAGTCCCTTCTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-729s21c1
Sequence:CCGGGTCCTGTCTAAAGCTCAAAGTCTCGAGACTTTGAGCTTTAGACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-804s21c1
Sequence:CCGGTTTCGATGTTAACGACAAAGTCTCGAGACTTTGTCGTTAACATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-782s21c1
Sequence:CCGGCTATAGGTGTTCATGATCGTGCTCGAGCACGATCATGAACACCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-756s1c1
Sequence:CCGGGAGACCAACAAATAGCTGTATCTCGAGATACAGCTATTTGTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-514s1c1
Sequence:CCGGGTCCTCTACATGGTGAACTTTCTCGAGAAAGTTCACCATGTAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-891s1c1
Sequence:CCGGCGCGGCACAAACACCAAGGATCTCGAGATCCTTGGTGTTTGTGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-707s1c1
Sequence:CCGGCAATCCCAGATAATGGAAGAACTCGAGTTCTTCCATTATCTGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001962.1-555s1c1
Sequence:CCGGCCACACTTCCAAAGGGTTCAACTCGAGTTGAACCCTTTGGAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001962
VALIDATED
EFNA5 MISSION shRNA Lentiviral Transduction Particles
ephrin-A5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-841s21c1
Sequence:CCGGCCAGCAGATGACACCGTACATCTCGAGATGTACGGTGTCATCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-417s21c1
Sequence:CCGGGGGTGACTACCATATTGATGTCTCGAGACATCAATATGGTAGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001962.2-1043s21c1
Sequence:CCGGTCCTAAGAAGGGACTTGTTATCTCGAGATAACAAGTCCCTTCTTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-729s21c1
Sequence:CCGGGTCCTGTCTAAAGCTCAAAGTCTCGAGACTTTGAGCTTTAGACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-804s21c1
Sequence:CCGGTTTCGATGTTAACGACAAAGTCTCGAGACTTTGTCGTTAACATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001962.2-782s21c1
Sequence:CCGGCTATAGGTGTTCATGATCGTGCTCGAGCACGATCATGAACACCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-756s1c1
Sequence:CCGGGAGACCAACAAATAGCTGTATCTCGAGATACAGCTATTTGTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-514s1c1
Sequence:CCGGGTCCTCTACATGGTGAACTTTCTCGAGAAAGTTCACCATGTAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-891s1c1
Sequence:CCGGCGCGGCACAAACACCAAGGATCTCGAGATCCTTGGTGTTTGTGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001962.1-707s1c1
Sequence:CCGGCAATCCCAGATAATGGAAGAACTCGAGTTCTTCCATTATCTGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001962.1-555s1c1
Sequence:CCGGCCACACTTCCAAAGGGTTCAACTCGAGTTGAACCCTTTGGAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010109
EFNA5 MISSION shRNA Bacterial Glycerol Stock
ephrin-A5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010109.3-586s21c1
Sequence:CCGGCCGAGAGTATTTCTACATCTCCTCGAGGAGATGTAGAAATACTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010109.3-460s21c1
Sequence:CCGGCCACACGTCCAAAGGGTTCAACTCGAGTTGAACCCTTTGGACGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010109.3-1254s21c1
Sequence:CCGGGTCAGGACAGTAAGGTGATTGCTCGAGCAATCACCTTACTGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-418s1c1
Sequence:CCGGCGTCCTGTACATGGTGAATTTCTCGAGAAATTCACCATGTACAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010109.2-2092s1c1
Sequence:CCGGCGTGTTTATCTGTGGGAGATACTCGAGTATCTCCCACAGATAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-625s1c1
Sequence:CCGGCGGAAGAAGGTCCTGTCTAAACTCGAGTTTAGACAGGACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-665s1c1
Sequence:CCGGCCAACAAATGACACCGTACATCTCGAGATGTACGGTGTCATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-327s1c1
Sequence:CCGGACTACCACATTGATGTCTGTACTCGAGTACAGACATCAATGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010109
EFNA5 MISSION shRNA shRNA Plasmid DNA
ephrin-A5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010109.3-586s21c1
Sequence:CCGGCCGAGAGTATTTCTACATCTCCTCGAGGAGATGTAGAAATACTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010109.3-460s21c1
Sequence:CCGGCCACACGTCCAAAGGGTTCAACTCGAGTTGAACCCTTTGGACGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010109.3-1254s21c1
Sequence:CCGGGTCAGGACAGTAAGGTGATTGCTCGAGCAATCACCTTACTGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-418s1c1
Sequence:CCGGCGTCCTGTACATGGTGAATTTCTCGAGAAATTCACCATGTACAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010109.2-2092s1c1
Sequence:CCGGCGTGTTTATCTGTGGGAGATACTCGAGTATCTCCCACAGATAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-625s1c1
Sequence:CCGGCGGAAGAAGGTCCTGTCTAAACTCGAGTTTAGACAGGACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-665s1c1
Sequence:CCGGCCAACAAATGACACCGTACATCTCGAGATGTACGGTGTCATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-327s1c1
Sequence:CCGGACTACCACATTGATGTCTGTACTCGAGTACAGACATCAATGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010109
EFNA5 MISSION shRNA Lentiviral Transduction Particles
ephrin-A5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010109.3-586s21c1
Sequence:CCGGCCGAGAGTATTTCTACATCTCCTCGAGGAGATGTAGAAATACTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010109.3-460s21c1
Sequence:CCGGCCACACGTCCAAAGGGTTCAACTCGAGTTGAACCCTTTGGACGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010109.3-1254s21c1
Sequence:CCGGGTCAGGACAGTAAGGTGATTGCTCGAGCAATCACCTTACTGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-418s1c1
Sequence:CCGGCGTCCTGTACATGGTGAATTTCTCGAGAAATTCACCATGTACAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010109.2-2092s1c1
Sequence:CCGGCGTGTTTATCTGTGGGAGATACTCGAGTATCTCCCACAGATAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-625s1c1
Sequence:CCGGCGGAAGAAGGTCCTGTCTAAACTCGAGTTTAGACAGGACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-665s1c1
Sequence:CCGGCCAACAAATGACACCGTACATCTCGAGATGTACGGTGTCATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010109.2-327s1c1
Sequence:CCGGACTACCACATTGATGTCTGTACTCGAGTACAGACATCAATGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks