EMAIL THIS PAGE TO A FRIEND

EFNB1

ephrin-B1

163 Gene Product Result for
Synonyms: CFND CFNS EFL3 EPLG2 Elk-L LERK2
UniProtKB ID: P98172, D3DVU0
Gene ID:
Human(1947) Summary: The protein encoded by this gene is a type I membrane protein and a ligand of Eph-related receptor tyrosine kinases. It may play a role in cell adhesion and function in the development or maintenance of the nervous system. [provided by RefSeq, Jul 2008]
Mouse(13641) ephrin B1
Rat(25186) ephrin B1
Zebrafish(114377) ephrin B1
cow(534413) ephrin-B1
dog(607410) ephrin-B1
chicken(395896) ephrin-B1
sheep(101120475) ephrin-B1
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004429 Rosetta Predictions human pricing
NM_017089 Rosetta Predictions rat pricing
NM_010110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105992 predicted 1274
2 SASI_Hs01_00105995 predicted 948
3 SASI_Hs01_00105996 predicted 1692
4 SASI_Hs01_00105997 predicted 2154
5 SASI_Hs02_00337596 predicted 913
6 SASI_Hs01_00105998 predicted 1084
7 SASI_Hs01_00105999 predicted 987
8 SASI_Hs01_00106000 predicted 2154
9 SASI_Hs01_00106001 predicted 1318
10 SASI_Hs02_00337597 predicted 2141
11 SASI_Hs01_00105993 predicted 1103
12 SASI_Hs01_00105994 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087387 predicted 920
2 SASI_Rn01_00087388 predicted 1238
3 SASI_Rn01_00087389 predicted 836
4 SASI_Rn02_00261303 predicted 1098
5 SASI_Rn01_00087390 predicted 1065
6 SASI_Rn01_00087391 predicted 1077
7 SASI_Rn01_00087392 predicted 1288
8 SASI_Rn01_00087393 predicted 1128
9 SASI_Rn01_00087394 predicted 860
10 SASI_Rn01_00087395 predicted 1151
11 SASI_Rn01_00087386 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058103 predicted 1219
2 SASI_Mm01_00058105 predicted 1136
3 SASI_Mm01_00058106 predicted 1669
4 SASI_Mm01_00058107 predicted 1249
5 SASI_Mm01_00058108 predicted 1230
6 SASI_Mm01_00058109 predicted 1757
7 SASI_Mm01_00058110 predicted 923
8 SASI_Mm01_00058111 predicted 1103
9 SASI_Mm01_00058112 predicted 1873
10 SASI_Mm02_00317825 predicted 1209
11 SASI_Mm01_00058104 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004429
EFNB1 MISSION shRNA Bacterial Glycerol Stock
ephrin-B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1569s1c1
Sequence:CCGGCCTACTACTGAAGCTACGCAACTCGAGTTGCGTAGCTTCAGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1172s1c1
Sequence:CCGGAGCACCATGATTACTACATTACTCGAGTAATGTAGTAATCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1099s1c1
Sequence:CCGGCCAGAGCAGGAAATACGCTTTCTCGAGAAAGCGTATTTCCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1704s1c1
Sequence:CCGGCTTACGGACTACAGAGAACAACTCGAGTTGTTCTCTGTAGTCCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1687s1c1
Sequence:CCGGAGCGACATCATCATTCCCTTACTCGAGTAAGGGAATGATGATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004429.4-1263s21c1
Sequence:CCGGCATGAAGGTTGGGCAAGATCCCTCGAGGGATCTTGCCCAACCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004429.4-2161s21c1
Sequence:CCGGGGACTGCTTGTCCGCTATCATCTCGAGATGATAGCGGACAAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004429.4-1067s21c1
Sequence:CCGGACGTGTTGGTCACCTGCAATACTCGAGTATTGCAGGTGACCAACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004429
EFNB1 MISSION shRNA shRNA Plasmid DNA
ephrin-B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1569s1c1
Sequence:CCGGCCTACTACTGAAGCTACGCAACTCGAGTTGCGTAGCTTCAGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1172s1c1
Sequence:CCGGAGCACCATGATTACTACATTACTCGAGTAATGTAGTAATCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1099s1c1
Sequence:CCGGCCAGAGCAGGAAATACGCTTTCTCGAGAAAGCGTATTTCCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1704s1c1
Sequence:CCGGCTTACGGACTACAGAGAACAACTCGAGTTGTTCTCTGTAGTCCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1687s1c1
Sequence:CCGGAGCGACATCATCATTCCCTTACTCGAGTAAGGGAATGATGATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004429.4-1263s21c1
Sequence:CCGGCATGAAGGTTGGGCAAGATCCCTCGAGGGATCTTGCCCAACCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004429.4-2161s21c1
Sequence:CCGGGGACTGCTTGTCCGCTATCATCTCGAGATGATAGCGGACAAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004429.4-1067s21c1
Sequence:CCGGACGTGTTGGTCACCTGCAATACTCGAGTATTGCAGGTGACCAACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004429
EFNB1 MISSION shRNA Lentiviral Transduction Particles
ephrin-B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1569s1c1
Sequence:CCGGCCTACTACTGAAGCTACGCAACTCGAGTTGCGTAGCTTCAGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1172s1c1
Sequence:CCGGAGCACCATGATTACTACATTACTCGAGTAATGTAGTAATCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1099s1c1
Sequence:CCGGCCAGAGCAGGAAATACGCTTTCTCGAGAAAGCGTATTTCCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1704s1c1
Sequence:CCGGCTTACGGACTACAGAGAACAACTCGAGTTGTTCTCTGTAGTCCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004429.3-1687s1c1
Sequence:CCGGAGCGACATCATCATTCCCTTACTCGAGTAAGGGAATGATGATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004429.4-1263s21c1
Sequence:CCGGCATGAAGGTTGGGCAAGATCCCTCGAGGGATCTTGCCCAACCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004429.4-2161s21c1
Sequence:CCGGGGACTGCTTGTCCGCTATCATCTCGAGATGATAGCGGACAAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004429.4-1067s21c1
Sequence:CCGGACGTGTTGGTCACCTGCAATACTCGAGTATTGCAGGTGACCAACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010110
VALIDATED
EFNB1 MISSION shRNA Bacterial Glycerol Stock
ephrin-B1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-1222s1c1
Sequence:CCGGCCGCACTATGAAGATCGTTATCTCGAGATAACGATCTTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-880s1c1
Sequence:CCGGCCCTAAGTTCCTAAGTGGGAACTCGAGTTCCCACTTAGGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-1153s1c1
Sequence:CCGGCTACATTACATCAACGTCCAACTCGAGTTGGACGTTGATGTAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-904s1c1
Sequence:CCGGCTTGGTGATCTACCCGAAGATCTCGAGATCTTCGGGTAGATCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010110.2-1453s1c1
Sequence:CCGGCTTCAACTCCAAGGTAGCATTCTCGAGAATGCTACCTTGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-879s21c1
Sequence:CCGGCCCTAAGTTCCTAAGTGGGAACTCGAGTTCCCACTTAGGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-903s21c1
Sequence:CCGGCTTGGTGATCTACCCGAAGATCTCGAGATCTTCGGGTAGATCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-1452s21c1
Sequence:CCGGCTTCAACTCCAAGGTAGCATTCTCGAGAATGCTACCTTGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-1221s21c1
Sequence:CCGGCCGCACTATGAAGATCGTTATCTCGAGATAACGATCTTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010110
VALIDATED
EFNB1 MISSION shRNA shRNA Plasmid DNA
ephrin-B1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-1222s1c1
Sequence:CCGGCCGCACTATGAAGATCGTTATCTCGAGATAACGATCTTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-880s1c1
Sequence:CCGGCCCTAAGTTCCTAAGTGGGAACTCGAGTTCCCACTTAGGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-1153s1c1
Sequence:CCGGCTACATTACATCAACGTCCAACTCGAGTTGGACGTTGATGTAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-904s1c1
Sequence:CCGGCTTGGTGATCTACCCGAAGATCTCGAGATCTTCGGGTAGATCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010110.2-1453s1c1
Sequence:CCGGCTTCAACTCCAAGGTAGCATTCTCGAGAATGCTACCTTGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-879s21c1
Sequence:CCGGCCCTAAGTTCCTAAGTGGGAACTCGAGTTCCCACTTAGGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-903s21c1
Sequence:CCGGCTTGGTGATCTACCCGAAGATCTCGAGATCTTCGGGTAGATCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-1452s21c1
Sequence:CCGGCTTCAACTCCAAGGTAGCATTCTCGAGAATGCTACCTTGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-1221s21c1
Sequence:CCGGCCGCACTATGAAGATCGTTATCTCGAGATAACGATCTTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010110
VALIDATED
EFNB1 MISSION shRNA Lentiviral Transduction Particles
ephrin-B1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-1222s1c1
Sequence:CCGGCCGCACTATGAAGATCGTTATCTCGAGATAACGATCTTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-880s1c1
Sequence:CCGGCCCTAAGTTCCTAAGTGGGAACTCGAGTTCCCACTTAGGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-1153s1c1
Sequence:CCGGCTACATTACATCAACGTCCAACTCGAGTTGGACGTTGATGTAATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010110.2-904s1c1
Sequence:CCGGCTTGGTGATCTACCCGAAGATCTCGAGATCTTCGGGTAGATCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010110.2-1453s1c1
Sequence:CCGGCTTCAACTCCAAGGTAGCATTCTCGAGAATGCTACCTTGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-879s21c1
Sequence:CCGGCCCTAAGTTCCTAAGTGGGAACTCGAGTTCCCACTTAGGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-903s21c1
Sequence:CCGGCTTGGTGATCTACCCGAAGATCTCGAGATCTTCGGGTAGATCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-1452s21c1
Sequence:CCGGCTTCAACTCCAAGGTAGCATTCTCGAGAATGCTACCTTGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010110.4-1221s21c1
Sequence:CCGGCCGCACTATGAAGATCGTTATCTCGAGATAACGATCTTCATAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks