EMAIL THIS PAGE TO A FRIEND

EFNB2

ephrin-B2

Synonyms: EPLG5 HTKL Htk-L LERK5
UniProtKB ID: P52799, Q5JV56
Gene ID:
Human(1948) Summary: This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
Mouse(13642) ephrin B2
Rat(306636) ephrin B2
sheep(101115469) ephrin-B2
chicken(395625) ephrin-B2
dog(611745) ephrin-B2
cow(100139818) ephrin-B2
Horse(100064730) ephrin-B2
257 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300455 Anti-EFNB2 (Ab-316) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4300456 Anti-EFNB2 (Ab-330) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB2501389 Anti-EFNB2 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, mouse, human, rat, canine
ELISA, western blot pricing
HPA008999 Anti-EFNB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300632 Anti-Ephrin-B2 (pTyr330) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
E7525 Anti-Ephrin-B2 antibody produced in goat affinity isolated antibody mouse
flow cytometry, immunocytochemistry, western blot pricing
SAB4503761 Anti-phospho-EFNB1/2 (pTyr330) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504684 Anti-phospho-Ephrin B1/B2/B3 (pTyr324) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4300631 Anti-phospho-Ephrin-B2 (pTyr316) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4200120 Monoclonal Anti-Ephrin-B2 antibody produced in mouse ~1.0 mg/mL, clone EFR-163M, purified immunoglobulin human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004093 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004093 Rosetta Predictions human pricing
NM_001107328 Rosetta Predictions rat pricing
NM_010111 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230189 predicted 1495
2 SASI_Hs01_00230190 predicted 1490
3 SASI_Hs01_00230191 predicted 1488
4 SASI_Hs01_00230192 predicted 1171
5 SASI_Hs02_00336899 predicted 445
6 SASI_Hs01_00230194 predicted 401
7 SASI_Hs01_00230195 predicted 282
8 SASI_Hs01_00230196 predicted 1245
9 SASI_Hs01_00230197 predicted 355
10 SASI_Hs02_00336900 predicted 1443
11 SASI_Hs01_00230188 predicted 417
12 SASI_Hs01_00230193 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227755 predicted 626
2 SASI_Rn02_00227756 predicted 400
3 SASI_Rn02_00227757 predicted 533
4 SASI_Rn02_00227758 predicted 402
5 SASI_Rn02_00227759 predicted 871
6 SASI_Rn02_00227760 predicted 273
7 SASI_Rn02_00227761 predicted 431
8 SASI_Rn02_00227762 predicted 880
9 SASI_Rn02_00227763 predicted 622
10 SASI_Rn02_00227764 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317826 predicted 780
2 SASI_Mm01_00201186 predicted 1028
3 SASI_Mm01_00201187 predicted 1024
4 SASI_Mm01_00201188 predicted 549
5 SASI_Mm01_00201189 predicted 327
6 SASI_Mm01_00201190 predicted 425
7 SASI_Mm01_00201192 predicted 859
8 SASI_Mm01_00201193 predicted 757
9 SASI_Mm01_00201194 predicted 275
10 SASI_Mm01_00201195 predicted 503
11 SASI_Mm01_00201191 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010111
VALIDATED
EFNB2 MISSION shRNA Bacterial Glycerol Stock
ephrin-B2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-574s21c1
Sequence:CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-718s21c1
Sequence:CCGGGAGCTAGAAGCTGGTACAAATCTCGAGATTTGTACCAGCTTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-300s21c1
Sequence:CCGGCGGACAAGGCCTGGTACTATACTCGAGTATAGTACCAGGCCTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010111.5-1518s21c1
Sequence:CCGGTGCCGTGCACACTGGACTTATCTCGAGATAAGTCCAGTGTGCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-330s21c1
Sequence:CCGGAGGAGACAAATTGGATATTATCTCGAGATAATATCCAATTTGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010111.2-3818s1c1
Sequence:CCGGCGGGTGTTACAGTAGCCTTATCTCGAGATAAGGCTACTGTAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-484s1c1
Sequence:CCGGCCAAGATGTGAAATTCACCATCTCGAGATGGTGAATTTCACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-1029s1c1
Sequence:CCGGGTGACGTTATCATACCACTAACTCGAGTTAGTGGTATGATAACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-435s1c1
Sequence:CCGGGCACAATTAAGAAGGAGAATACTCGAGTATTCTCCTTCTTAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-862s1c1
Sequence:CCGGCGCATCAGGATGCATCATCTTCTCGAGAAGATGATGCATCCTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010111
VALIDATED
EFNB2 MISSION shRNA shRNA Plasmid DNA
ephrin-B2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-574s21c1
Sequence:CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-718s21c1
Sequence:CCGGGAGCTAGAAGCTGGTACAAATCTCGAGATTTGTACCAGCTTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-300s21c1
Sequence:CCGGCGGACAAGGCCTGGTACTATACTCGAGTATAGTACCAGGCCTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010111.5-1518s21c1
Sequence:CCGGTGCCGTGCACACTGGACTTATCTCGAGATAAGTCCAGTGTGCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-330s21c1
Sequence:CCGGAGGAGACAAATTGGATATTATCTCGAGATAATATCCAATTTGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010111.2-3818s1c1
Sequence:CCGGCGGGTGTTACAGTAGCCTTATCTCGAGATAAGGCTACTGTAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-484s1c1
Sequence:CCGGCCAAGATGTGAAATTCACCATCTCGAGATGGTGAATTTCACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-1029s1c1
Sequence:CCGGGTGACGTTATCATACCACTAACTCGAGTTAGTGGTATGATAACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-435s1c1
Sequence:CCGGGCACAATTAAGAAGGAGAATACTCGAGTATTCTCCTTCTTAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-862s1c1
Sequence:CCGGCGCATCAGGATGCATCATCTTCTCGAGAAGATGATGCATCCTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010111
VALIDATED
EFNB2 MISSION shRNA Lentiviral Transduction Particles
ephrin-B2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-574s21c1
Sequence:CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-718s21c1
Sequence:CCGGGAGCTAGAAGCTGGTACAAATCTCGAGATTTGTACCAGCTTCTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-300s21c1
Sequence:CCGGCGGACAAGGCCTGGTACTATACTCGAGTATAGTACCAGGCCTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010111.5-1518s21c1
Sequence:CCGGTGCCGTGCACACTGGACTTATCTCGAGATAAGTCCAGTGTGCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010111.5-330s21c1
Sequence:CCGGAGGAGACAAATTGGATATTATCTCGAGATAATATCCAATTTGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010111.2-3818s1c1
Sequence:CCGGCGGGTGTTACAGTAGCCTTATCTCGAGATAAGGCTACTGTAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-484s1c1
Sequence:CCGGCCAAGATGTGAAATTCACCATCTCGAGATGGTGAATTTCACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-1029s1c1
Sequence:CCGGGTGACGTTATCATACCACTAACTCGAGTTAGTGGTATGATAACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-435s1c1
Sequence:CCGGGCACAATTAAGAAGGAGAATACTCGAGTATTCTCCTTCTTAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010111.2-862s1c1
Sequence:CCGGCGCATCAGGATGCATCATCTTCTCGAGAAGATGATGCATCCTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004093
VALIDATED
EFNB2 MISSION shRNA Bacterial Glycerol Stock
ephrin-B2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004093.2-1051s21c1
Sequence:CCGGCTTTCCCAGAGGACACCTAATCTCGAGATTAGGTGTCCTCTGGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-431s21c1
Sequence:CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-280s21c1
Sequence:CCGGAGCAGACAGATGCACTATTAACTCGAGTTAATAGTGCATCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-230s21c1
Sequence:CCGGACTGTTGGCCAGTATGAATATCTCGAGATATTCATACTGGCCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-132s21c1
Sequence:CCGGATTCCTCGAACTCCAAATTTCCTCGAGGAAATTTGGAGTTCGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004093.2-546s1c1
Sequence:CCGGCCAGGAATAAAGATCCAACAACTCGAGTTGTTGGATCTTTATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-606s1c1
Sequence:CCGGCGACAACAAGTCCCTTTGTAACTCGAGTTACAAAGGGACTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004093.2-93s1c1
Sequence:CCGGCGATTTCCAAATCGATAGTTTCTCGAGAAACTATCGATTTGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-702s1c1
Sequence:CCGGCCTTATTTGCAGGGATTGCTTCTCGAGAAGCAATCCCTGCAAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-167s1c1
Sequence:CCGGCTGGTACTATACCCACAGATACTCGAGTATCTGTGGGTATAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004093
VALIDATED
EFNB2 MISSION shRNA shRNA Plasmid DNA
ephrin-B2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004093.2-1051s21c1
Sequence:CCGGCTTTCCCAGAGGACACCTAATCTCGAGATTAGGTGTCCTCTGGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-431s21c1
Sequence:CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-280s21c1
Sequence:CCGGAGCAGACAGATGCACTATTAACTCGAGTTAATAGTGCATCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-230s21c1
Sequence:CCGGACTGTTGGCCAGTATGAATATCTCGAGATATTCATACTGGCCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-132s21c1
Sequence:CCGGATTCCTCGAACTCCAAATTTCCTCGAGGAAATTTGGAGTTCGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004093.2-546s1c1
Sequence:CCGGCCAGGAATAAAGATCCAACAACTCGAGTTGTTGGATCTTTATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-606s1c1
Sequence:CCGGCGACAACAAGTCCCTTTGTAACTCGAGTTACAAAGGGACTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004093.2-93s1c1
Sequence:CCGGCGATTTCCAAATCGATAGTTTCTCGAGAAACTATCGATTTGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-702s1c1
Sequence:CCGGCCTTATTTGCAGGGATTGCTTCTCGAGAAGCAATCCCTGCAAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-167s1c1
Sequence:CCGGCTGGTACTATACCCACAGATACTCGAGTATCTGTGGGTATAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004093
VALIDATED
EFNB2 MISSION shRNA Lentiviral Transduction Particles
ephrin-B2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004093.2-1051s21c1
Sequence:CCGGCTTTCCCAGAGGACACCTAATCTCGAGATTAGGTGTCCTCTGGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-431s21c1
Sequence:CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-280s21c1
Sequence:CCGGAGCAGACAGATGCACTATTAACTCGAGTTAATAGTGCATCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-230s21c1
Sequence:CCGGACTGTTGGCCAGTATGAATATCTCGAGATATTCATACTGGCCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004093.2-132s21c1
Sequence:CCGGATTCCTCGAACTCCAAATTTCCTCGAGGAAATTTGGAGTTCGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004093.2-546s1c1
Sequence:CCGGCCAGGAATAAAGATCCAACAACTCGAGTTGTTGGATCTTTATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-606s1c1
Sequence:CCGGCGACAACAAGTCCCTTTGTAACTCGAGTTACAAAGGGACTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004093.2-93s1c1
Sequence:CCGGCGATTTCCAAATCGATAGTTTCTCGAGAAACTATCGATTTGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-702s1c1
Sequence:CCGGCCTTATTTGCAGGGATTGCTTCTCGAGAAGCAATCCCTGCAAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004093.2-167s1c1
Sequence:CCGGCTGGTACTATACCCACAGATACTCGAGTATCTGTGGGTATAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks