EMAIL THIS PAGE TO A FRIEND

EFNB3

ephrin-B3

168 Gene Product Result for
Synonyms: EFL6 EPLG8 LERK8
UniProtKB ID: Q15768, B2RBW2, D3DTQ6, O00680, Q8TBH7, Q92875
Gene ID:
Human(1949) Summary: EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
Mouse(13643) ephrin B3
Rat(360546) ephrin B3
dog(607903) ephrin-B3
cow(617714) ephrin-B3
Horse(100062080) ephrin-B3
sheep(101103994) ephrin-B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153761 MISSION® esiRNA esiRNA human EFNB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001406 Rosetta Predictions human pricing
NM_001100980 Rosetta Predictions rat pricing
NM_007911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213293 predicted 931
2 SASI_Hs01_00213294 predicted 536
3 SASI_Hs01_00213295 predicted 611
4 SASI_Hs01_00213296 predicted 609
5 SASI_Hs01_00213298 predicted 1883
6 SASI_Hs01_00213299 predicted 1594
7 SASI_Hs01_00213300 predicted 1357
8 SASI_Hs01_00213301 predicted 1391
9 SASI_Hs01_00213302 predicted 1416
10 SASI_Hs02_00331788 predicted 1336
11 SASI_Hs01_00213297 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210942 predicted 590
2 SASI_Rn02_00210943 predicted 452
3 SASI_Rn02_00210944 predicted 756
4 SASI_Rn02_00210945 predicted 767
5 SASI_Rn02_00210946 predicted 507
6 SASI_Rn02_00210947 predicted 592
7 SASI_Rn02_00210948 predicted 589
8 SASI_Rn02_00210949 predicted 1444
9 SASI_Rn02_00210950 predicted 684
10 SASI_Rn02_00210951 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188569 predicted 581
2 SASI_Mm01_00188570 predicted 498
3 SASI_Mm01_00188571 predicted 1355
4 SASI_Mm01_00188572 predicted 1362
5 SASI_Mm01_00188573 predicted 1306
6 SASI_Mm01_00188574 predicted 755
7 SASI_Mm01_00188576 predicted 702
8 SASI_Mm02_00312722 predicted 812
9 SASI_Mm01_00188577 predicted 678
10 SASI_Mm01_00188578 predicted 1459
11 SASI_Mm01_00188575 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001406
EFNB3 MISSION shRNA Bacterial Glycerol Stock
ephrin-B3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-790s1c1
Sequence:CCGGGCACCACGATTACTACATCATCTCGAGATGATGTAGTAATCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-1393s1c1
Sequence:CCGGCCCTCCAAACATCTACTACAACTCGAGTTGTAGTAGATGTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-496s1c1
Sequence:CCGGCTACTGGAACTCGGCGAATAACTCGAGTTATTCGCCGAGTTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-745s1c1
Sequence:CCGGGTTCCAGGAGTATAGCCCTAACTCGAGTTAGGGCTATACTCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-604s1c1
Sequence:CCGGCCCTCACTCCTCTCCTAATTACTCGAGTAATTAGGAGAGGAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1802s21c1
Sequence:CCGGTCTCTTCTCTATCTCTTATTCCTCGAGGAATAAGAGATAGAGAAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1886s21c1
Sequence:CCGGTTCACCCTCTTGGCTTCTTATCTCGAGATAAGAAGCCAAGAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1429s21c1
Sequence:CCGGCTCACGTGGCTATCCTGAATCCTCGAGGATTCAGGATAGCCACGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001406
EFNB3 MISSION shRNA shRNA Plasmid DNA
ephrin-B3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-790s1c1
Sequence:CCGGGCACCACGATTACTACATCATCTCGAGATGATGTAGTAATCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-1393s1c1
Sequence:CCGGCCCTCCAAACATCTACTACAACTCGAGTTGTAGTAGATGTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-496s1c1
Sequence:CCGGCTACTGGAACTCGGCGAATAACTCGAGTTATTCGCCGAGTTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-745s1c1
Sequence:CCGGGTTCCAGGAGTATAGCCCTAACTCGAGTTAGGGCTATACTCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-604s1c1
Sequence:CCGGCCCTCACTCCTCTCCTAATTACTCGAGTAATTAGGAGAGGAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1802s21c1
Sequence:CCGGTCTCTTCTCTATCTCTTATTCCTCGAGGAATAAGAGATAGAGAAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1886s21c1
Sequence:CCGGTTCACCCTCTTGGCTTCTTATCTCGAGATAAGAAGCCAAGAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1429s21c1
Sequence:CCGGCTCACGTGGCTATCCTGAATCCTCGAGGATTCAGGATAGCCACGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001406
EFNB3 MISSION shRNA Lentiviral Transduction Particles
ephrin-B3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-790s1c1
Sequence:CCGGGCACCACGATTACTACATCATCTCGAGATGATGTAGTAATCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-1393s1c1
Sequence:CCGGCCCTCCAAACATCTACTACAACTCGAGTTGTAGTAGATGTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-496s1c1
Sequence:CCGGCTACTGGAACTCGGCGAATAACTCGAGTTATTCGCCGAGTTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-745s1c1
Sequence:CCGGGTTCCAGGAGTATAGCCCTAACTCGAGTTAGGGCTATACTCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001406.3-604s1c1
Sequence:CCGGCCCTCACTCCTCTCCTAATTACTCGAGTAATTAGGAGAGGAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1802s21c1
Sequence:CCGGTCTCTTCTCTATCTCTTATTCCTCGAGGAATAAGAGATAGAGAAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1886s21c1
Sequence:CCGGTTCACCCTCTTGGCTTCTTATCTCGAGATAAGAAGCCAAGAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001406.3-1429s21c1
Sequence:CCGGCTCACGTGGCTATCCTGAATCCTCGAGGATTCAGGATAGCCACGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007911
EFNB3 MISSION shRNA Bacterial Glycerol Stock
ephrin-B3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-1329s1c1
Sequence:CCGGCCTGTGTACATTGTGCAGGATCTCGAGATCCTGCACAATGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-715s1c1
Sequence:CCGGAGTTCCAGGAATACAGCCCTACTCGAGTAGGGCTGTATTCCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-1364s1c1
Sequence:CCGGCCCTCCGAACATCTATTACAACTCGAGTTGTAATAGATGTTCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-762s1c1
Sequence:CCGGCACCACGATTACTACATAATTCTCGAGAATTATGTAGTAATCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-588s1c1
Sequence:CCGGCCTAGTTATGAGTTCTACAAACTCGAGTTTGTAGAACTCATAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007911
EFNB3 MISSION shRNA shRNA Plasmid DNA
ephrin-B3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-1329s1c1
Sequence:CCGGCCTGTGTACATTGTGCAGGATCTCGAGATCCTGCACAATGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-715s1c1
Sequence:CCGGAGTTCCAGGAATACAGCCCTACTCGAGTAGGGCTGTATTCCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-1364s1c1
Sequence:CCGGCCCTCCGAACATCTATTACAACTCGAGTTGTAATAGATGTTCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-762s1c1
Sequence:CCGGCACCACGATTACTACATAATTCTCGAGAATTATGTAGTAATCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-588s1c1
Sequence:CCGGCCTAGTTATGAGTTCTACAAACTCGAGTTTGTAGAACTCATAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007911
EFNB3 MISSION shRNA Lentiviral Transduction Particles
ephrin-B3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-1329s1c1
Sequence:CCGGCCTGTGTACATTGTGCAGGATCTCGAGATCCTGCACAATGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-715s1c1
Sequence:CCGGAGTTCCAGGAATACAGCCCTACTCGAGTAGGGCTGTATTCCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-1364s1c1
Sequence:CCGGCCCTCCGAACATCTATTACAACTCGAGTTGTAATAGATGTTCGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-762s1c1
Sequence:CCGGCACCACGATTACTACATAATTCTCGAGAATTATGTAGTAATCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007911.3-588s1c1
Sequence:CCGGCCTAGTTATGAGTTCTACAAACTCGAGTTTGTAGAACTCATAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks