EMAIL THIS PAGE TO A FRIEND

EFR3A

EFR3 homolog A (S. cerevisiae)

UniProtKB ID: Q14156, A7MD19, Q2VPK2, Q63HL7, Q68DX1, Q6IQ18
Gene ID:
Human(23167) Summary: This gene encodes a membrane protein. Studies with orthologous gene in mouse show that it is differentially expressed in the auditory brainstem neurons of mice with hearing deficit, compared to mice with normal hearing ability, suggesting a role for this gene in hearing. [provided by RefSeq, Jan 2011]
Mouse(76740) EFR3 homolog A (S. cerevisiae)
Rat(362923) EFR3 homolog A (S. cerevisiae)
Zebrafish(393800) EFR3 homolog A (S. cerevisiae)
cow(535125) EFR3 homolog A (S. cerevisiae)
Horse(100057838) EFR3 homolog A (S. cerevisiae)
domestic cat(101092992) EFR3 homolog A (S. cerevisiae)
dog(475102) EFR3 homolog A (S. cerevisiae)
chicken(420327) EFR3 homolog A (S. cerevisiae)
naked mole-rat(101726451) EFR3 homolog A (S. cerevisiae)
domestic guinea pig(100730171) EFR3 homolog A (S. cerevisiae)
sheep(101121432) EFR3 homolog A (S. cerevisiae)
Domestic Rabbit(100355686) EFR3 homolog A (S. cerevisiae)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015137 Rosetta Predictions human pricing
NM_001130564 Rosetta Predictions rat pricing
NM_133766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193238 predicted 388
2 SASI_Hs01_00193239 predicted 393
3 SASI_Hs01_00193240 predicted 1128
4 SASI_Hs01_00193241 predicted 2004
5 SASI_Hs01_00193242 predicted 1153
6 SASI_Hs01_00193244 predicted 2225
7 SASI_Hs01_00193247 predicted 948
8 SASI_Hs02_00347063 predicted 1778
9 SASI_Hs02_00347064 predicted 2397
10 SASI_Hs02_00347065 predicted 2243
11 SASI_Hs01_00193243 predicted 1336
12 SASI_Hs01_00193245 predicted 1329
13 SASI_Hs01_00193246 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255809 predicted 285
2 SASI_Rn02_00255810 predicted 617
3 SASI_Rn02_00255811 predicted 1775
4 SASI_Rn02_00255812 predicted 2506
5 SASI_Rn02_00255813 predicted 472
6 SASI_Rn02_00255814 predicted 1371
7 SASI_Rn02_00255815 predicted 1489
8 SASI_Rn02_00255816 predicted 1744
9 SASI_Rn02_00255817 predicted 1886
10 SASI_Rn02_00255818 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110206 predicted 606
2 SASI_Mm01_00110207 predicted 1771
3 SASI_Mm01_00110208 predicted 2495
4 SASI_Mm01_00110209 predicted 464
5 SASI_Mm01_00110210 predicted 1362
6 SASI_Mm01_00110211 predicted 1873
7 SASI_Mm01_00110212 predicted 944
8 SASI_Mm02_00338769 predicted 745
9 SASI_Mm02_00338770 predicted 1052
10 SASI_Mm01_00110213 predicted 1859
11 SASI_Mm01_00110205 predicted 281
12 SASI_Mm01_00110214 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015137
VALIDATED
EFR3A MISSION shRNA Bacterial Glycerol Stock
EFR3 homolog A (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015137.3-2205s21c1
Sequence:CCGGGCTAGGTGGAAGTGGATATAGCTCGAGCTATATCCACTTCCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-2140s1c1
Sequence:CCGGCCGTATCCATTCAGGTGGATACTCGAGTATCCACCTGAATGGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015137.1-810s1c1
Sequence:CCGGGCGCATTTAGATCATCACAAACTCGAGTTTGTGATGATCTAAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-1719s1c1
Sequence:CCGGCTGGCTAATGAAGAAGTAGTTCTCGAGAACTACTTCTTCATTAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-1850s1c1
Sequence:CCGGCAACTTTGTAAGTCAGATGATCTCGAGATCATCTGACTTACAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-660s1c1
Sequence:CCGGGAAGAAGTTGACAGTCGCATACTCGAGTATGCGACTGTCAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-238s1c1
Sequence:CCGGGACATCGTTCTGGGTATGTTTCTCGAGAAACATACCCAGAACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-2769s1c1
Sequence:CCGGCCACTGTTAAGTAGTATGTTTCTCGAGAAACATACTACTTAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-2409s1c1
Sequence:CCGGCCATCAGGAACACTGACCATTCTCGAGAATGGTCAGTGTTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015137
VALIDATED
EFR3A MISSION shRNA shRNA Plasmid DNA
EFR3 homolog A (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015137.3-2205s21c1
Sequence:CCGGGCTAGGTGGAAGTGGATATAGCTCGAGCTATATCCACTTCCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-2140s1c1
Sequence:CCGGCCGTATCCATTCAGGTGGATACTCGAGTATCCACCTGAATGGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015137.1-810s1c1
Sequence:CCGGGCGCATTTAGATCATCACAAACTCGAGTTTGTGATGATCTAAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-1719s1c1
Sequence:CCGGCTGGCTAATGAAGAAGTAGTTCTCGAGAACTACTTCTTCATTAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-1850s1c1
Sequence:CCGGCAACTTTGTAAGTCAGATGATCTCGAGATCATCTGACTTACAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-660s1c1
Sequence:CCGGGAAGAAGTTGACAGTCGCATACTCGAGTATGCGACTGTCAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-238s1c1
Sequence:CCGGGACATCGTTCTGGGTATGTTTCTCGAGAAACATACCCAGAACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-2769s1c1
Sequence:CCGGCCACTGTTAAGTAGTATGTTTCTCGAGAAACATACTACTTAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-2409s1c1
Sequence:CCGGCCATCAGGAACACTGACCATTCTCGAGAATGGTCAGTGTTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015137
VALIDATED
EFR3A MISSION shRNA Lentiviral Transduction Particles
EFR3 homolog A (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015137.3-2205s21c1
Sequence:CCGGGCTAGGTGGAAGTGGATATAGCTCGAGCTATATCCACTTCCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-2140s1c1
Sequence:CCGGCCGTATCCATTCAGGTGGATACTCGAGTATCCACCTGAATGGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015137.1-810s1c1
Sequence:CCGGGCGCATTTAGATCATCACAAACTCGAGTTTGTGATGATCTAAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-1719s1c1
Sequence:CCGGCTGGCTAATGAAGAAGTAGTTCTCGAGAACTACTTCTTCATTAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-1850s1c1
Sequence:CCGGCAACTTTGTAAGTCAGATGATCTCGAGATCATCTGACTTACAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-660s1c1
Sequence:CCGGGAAGAAGTTGACAGTCGCATACTCGAGTATGCGACTGTCAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-238s1c1
Sequence:CCGGGACATCGTTCTGGGTATGTTTCTCGAGAAACATACCCAGAACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015137.1-2769s1c1
Sequence:CCGGCCACTGTTAAGTAGTATGTTTCTCGAGAAACATACTACTTAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015137.1-2409s1c1
Sequence:CCGGCCATCAGGAACACTGACCATTCTCGAGAATGGTCAGTGTTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133766
VALIDATED
EFR3A MISSION shRNA Bacterial Glycerol Stock
EFR3 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-4103s21c1
Sequence:CCGGGCTGCTGATTAAGTGCAGATACTCGAGTATCTGCACTTAATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-403s21c1
Sequence:CCGGCCGTTCTGGGTACGTTCTAATCTCGAGATTAGAACGTACCCAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-1076s21c1
Sequence:CCGGCAAGAGATTCTAGGACACCTTCTCGAGAAGGTGTCCTAGAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-247s21c1
Sequence:CCGGACGTCTGGTGGACAACATATTCTCGAGAATATGTTGTCCACCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-2297s21c1
Sequence:CCGGGTATCTATTCAGGTGGATATTCTCGAGAATATCCACCTGAATAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.3-2513s1c1
Sequence:CCGGCATGATAGACTTGCTCAAATACTCGAGTATTTGAGCAAGTCTATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.3-685s1c1
Sequence:CCGGGATTCGCATTGCTGGAATAAGCTCGAGCTTATTCCAGCAATGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-4108s1c1
Sequence:CCGGGCTGCTGATTAAGTGCAGATACTCGAGTATCTGCACTTAATCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-3808s1c1
Sequence:CCGGCCTGTTCAAATTCAGTTTCTTCTCGAGAAGAAACTGAATTTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-2301s1c1
Sequence:CCGGGTATCTATTCAGGTGGATATTCTCGAGAATATCCACCTGAATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.2-2047s1c1
Sequence:CCGGGCCAGCATGTTAGCAAGGTTACTCGAGTAACCTTGCTAACATGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-1080s1c1
Sequence:CCGGCAAGAGATTCTAGGACACCTTCTCGAGAAGGTGTCCTAGAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133766
VALIDATED
EFR3A MISSION shRNA shRNA Plasmid DNA
EFR3 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-4103s21c1
Sequence:CCGGGCTGCTGATTAAGTGCAGATACTCGAGTATCTGCACTTAATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-403s21c1
Sequence:CCGGCCGTTCTGGGTACGTTCTAATCTCGAGATTAGAACGTACCCAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-1076s21c1
Sequence:CCGGCAAGAGATTCTAGGACACCTTCTCGAGAAGGTGTCCTAGAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-247s21c1
Sequence:CCGGACGTCTGGTGGACAACATATTCTCGAGAATATGTTGTCCACCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-2297s21c1
Sequence:CCGGGTATCTATTCAGGTGGATATTCTCGAGAATATCCACCTGAATAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.3-2513s1c1
Sequence:CCGGCATGATAGACTTGCTCAAATACTCGAGTATTTGAGCAAGTCTATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.3-685s1c1
Sequence:CCGGGATTCGCATTGCTGGAATAAGCTCGAGCTTATTCCAGCAATGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-4108s1c1
Sequence:CCGGGCTGCTGATTAAGTGCAGATACTCGAGTATCTGCACTTAATCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-3808s1c1
Sequence:CCGGCCTGTTCAAATTCAGTTTCTTCTCGAGAAGAAACTGAATTTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-2301s1c1
Sequence:CCGGGTATCTATTCAGGTGGATATTCTCGAGAATATCCACCTGAATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.2-2047s1c1
Sequence:CCGGGCCAGCATGTTAGCAAGGTTACTCGAGTAACCTTGCTAACATGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-1080s1c1
Sequence:CCGGCAAGAGATTCTAGGACACCTTCTCGAGAAGGTGTCCTAGAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133766
VALIDATED
EFR3A MISSION shRNA Lentiviral Transduction Particles
EFR3 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-4103s21c1
Sequence:CCGGGCTGCTGATTAAGTGCAGATACTCGAGTATCTGCACTTAATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-403s21c1
Sequence:CCGGCCGTTCTGGGTACGTTCTAATCTCGAGATTAGAACGTACCCAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-1076s21c1
Sequence:CCGGCAAGAGATTCTAGGACACCTTCTCGAGAAGGTGTCCTAGAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-247s21c1
Sequence:CCGGACGTCTGGTGGACAACATATTCTCGAGAATATGTTGTCCACCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133766.3-2297s21c1
Sequence:CCGGGTATCTATTCAGGTGGATATTCTCGAGAATATCCACCTGAATAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.3-2513s1c1
Sequence:CCGGCATGATAGACTTGCTCAAATACTCGAGTATTTGAGCAAGTCTATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.3-685s1c1
Sequence:CCGGGATTCGCATTGCTGGAATAAGCTCGAGCTTATTCCAGCAATGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-4108s1c1
Sequence:CCGGGCTGCTGATTAAGTGCAGATACTCGAGTATCTGCACTTAATCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-3808s1c1
Sequence:CCGGCCTGTTCAAATTCAGTTTCTTCTCGAGAAGAAACTGAATTTGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-2301s1c1
Sequence:CCGGGTATCTATTCAGGTGGATATTCTCGAGAATATCCACCTGAATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133766.2-2047s1c1
Sequence:CCGGGCCAGCATGTTAGCAAGGTTACTCGAGTAACCTTGCTAACATGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133766.2-1080s1c1
Sequence:CCGGCAAGAGATTCTAGGACACCTTCTCGAGAAGGTGTCCTAGAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks